actin, beta (ACTB) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the ACTB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering ACTB transcript NM_001101.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTGATCTTCATTGTGCTGGGTGCCAGGGCAGTGATCTCCTTCTGCATCCTGTCGGCAAT       c.60
 L  D  L  H  C  A  G  C  Q  G  S  D  L  L  L  H  P  V  G  N         p.20

          .         .         .         .         .         .       g.120
 GCCAGGGTACATGGTGGTGCCGCCAGACAGCACTGTGTTGGCGTACAGGTCTTTGCGGAT       c.120
 A  R  V  H  G  G  A  A  R  Q  H  C  V  G  V  Q  V  F  A  D         p.40

          .         .         .         .         .         .       g.180
 GTCCACGTCACACTTCATGATGGAGTTGAAGGTAGTTTCGTGGATGCCACAGGACTCCAT       c.180
 V  H  V  T  L  H  D  G  V  E  G  S  F  V  D  A  T  G  L  H         p.60

    | 02     .         .         .         .         .         .    g.335
 GC | CCAGGAAGGAAGGCTGGAAGAGTGCCTCAGGGCAGCGGAACCGCTCATTGCCAATGGT    c.240
 A  |  Q  E  G  R  L  E  E  C  L  R  A  A  E  P  L  I  A  N  G      p.80

          .         .         .         .         .         .       g.395
 GATGACCTGGCCGTCAGGCAGCTCGTAGCTCTTCTCCAGGGAGGAGCTGGAAGCAGCCGT       c.300
 D  D  L  A  V  R  Q  L  V  A  L  L  Q  G  G  A  G  S  S  R         p.100

          .         .         .         .         .         .       g.455
 GGCCATCTCTTGCTCGAAGTCCAGGGCGACGTAGCACAGCTTCTCCTTAATGTCACGCAC       c.360
 G  H  L  L  L  E  V  Q  G  D  V  A  Q  L  L  L  N  V  T  H         p.120

          .         .         .         .         .         .       g.515
 GATTTCCCGCTCGGCCGTGGTGGTGAAGCTGTAGCCGCGCTCGGTGAGGATCTTCATGAG       c.420
 D  F  P  L  G  R  G  G  E  A  V  A  A  L  G  E  D  L  H  E         p.140

          .         .         .         .         .         .       g.575
 GTAGTCAGTCAGGTCCCGGCCAGCCAGGTCCAGACGCAGGATGGCATGGGGGAGGGCATA       c.480
 V  V  S  Q  V  P  A  S  Q  V  Q  T  Q  D  G  M  G  E  G  I         p.160

          .         .         .         .         .         .       g.635
 CCCCTCGTAGATGGGCACAGTGTGGGTGACCCCGTCACCGGAGTCCATCACGATGCCAGT       c.540
 P  L  V  D  G  H  S  V  G  D  P  V  T  G  V  H  H  D  A  S         p.180

          .         .                                               g.662
 GGTACGGCCAGAGGCGTACAGGGATAG                                        c.567
 G  T  A  R  G  V  Q  G  X                                          p.188

          .         .         .         .         .     | 03   .    g.1163
 cacagcctggatagcaacgtacatggctggggtgttgaaggtctcaaacatgat | ctgggt    c.*60

          .         .         .         .         .         .       g.1223
 catcttctcgcggttggccttggggttcaggggggcctcggtcagcagcacggggtgctc       c.*120

          .         .         .         .         .         .       g.1283
 ctcgggagccacacgcagctcattgtagaaggtgtggtgccagattttctccatgtcgtc       c.*180

          .         .         .         .         .         .       g.1343
 ccagttggtgacgatgccgtgctcgatggggtacttcagggtgaggatgcctctcttgct       c.*240

          .         .         .         .         .     | 04   .    g.1537
 ctgggcctcgtcgcccacataggaatccttctgacccatgcccaccatcacgcc | ctggtg    c.*300

          .         .         .         .         .         .       g.1597
 cctggggcgccccacgatggaggggaagacggcccggggggcatcgtcgcccgcgaagcc       c.*360

          .         .         .         .         .         .       g.1657
 ggccttgcacatgccggagccgttgtcgacgacgagcgcggcgatatcatcatccatggt       c.*420

     | 05    .         .         .         .         .         .    g.2577
 gag | ctggcggcgggtgtggacgggcggcggatcggcaaaggcgaggctctgtgctcgcgg    c.*480

          .         .  | 06      .         .         .         .                                          g.2637
 ggcggacgcggtctcggcggt | t                                          c.*502

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Actin, beta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.