ADAM metallopeptidase domain 17 (ADAM17) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the ADAM17 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering ADAM17 transcript NM_003183.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .  | 02      .    g.1806
 ACTGGGGTGAAACAGAGACAGAGATTCATACTGTTTATCCAATTTCTTATC | CACACAATG    c.60
 T  G  V  K  Q  R  Q  R  F  I  L  F  I  Q  F  L  I   | H  T  M      p.20

          .         .         .         .         .         .       g.1866
 GACAAGAATGCTGAAAGGAATCCAAAATATCAAGGAGAAAACCAGGACAGACCCAACGAT       c.120
 D  K  N  A  E  R  N  P  K  Y  Q  G  E  N  Q  D  R  P  N  D         p.40

          .                                                     g.1878
 GTTGTCTGCTAA |                                                    c.133
 V  V  C  X                                                      p.43

          | 03         .         .         .         .         .    g.2698
 aaactttc | caaaagtattgatgctcagctggtcaatgaaatcccaaaatcgttcaattac    c.*60

          .         .        | 04.         .         .         .    g.3569
 atcctgtactcgtttctcacatttgcc | attcatgtcacaaaatcctactgtacagggctt    c.*120

          .         .         .         .         .         .       g.3629
 tcctttcctcaaaaataagttcttttgttcagcatcgacatagggcacacagcggccaga       c.*180

          .         .         .         | 05         .         .    g.6035
 aaggtccctgcagcacaccttgcaggagttgtcagttt | cattacatgcacaggactccag    c.*240

          .         .         .         .         .         .       g.6095
 ctgctgttccctctcgcagaaagggatgcatttcccatccttacacttgccaagatccaa       c.*300

          .         .         .         .         .    | 06    .    g.11079
 gcaaacagtgtcatcttcagcatttcctggaggcgggcactcactgctattac | ctgtgca    c.*360

          .         .         .         .         .         .       g.11139
 gtaggacacgcctttgcaagtagcattaatcgcctcctggcacttcttctgggcagtctc       c.*420

          .         .         .        | 07.         .         .    g.14088
 aaactgacagtttttacagcaaggactgttcctgtca | ctgcactggacaccttccttcaa    c.*480

          .         .         .         .         .         .       g.14148
 cgtgcagtcgctgttgcagcaggtgtcgttgttcagatacatgatgccaggatcacactc       c.*540

          .         .         .         .         .         .       g.14208
 ttctccttcatccaccctcgagttcccacaaactttattgctgcgttcttgaaaacactc       c.*600

          .         .         .         .         .        | 08.    g.18881
 ctgggccttactttcaatggtcttatagattgattgtttactgcagtttgaaaacat | ctt    c.*660

          .         .         .         .         .         .       g.18941
 attgttctcgtgatcgccactcacagctatgggatacatgacatatttccctccctggtc       c.*720

          .         .         .         .         .         .       g.19001
 ctcattcggggcacattctgctagaccatccggatcatgttctgctccaaaattatgtcc       c.*780

          .         .         . | 09       .         .         .    g.26830
 caattcatgagttgtaaccaggtcagcttc | ctttgtaaggatggttttaccataattctt    c.*840

          .         .         .         .         .          | 10    g.27003
 tgtgctcgtcaaaccactattcaaatagatatttttcttcccaactgggctataataag | c    c.*900

          .         .         .         .         .         .       g.27063
 ctttggacaaacacctccatggctgtttgctctgggagagccaacataagctaatccaag       c.*960

          .         .         .         .         .         .       g.27123
 agttcccatatcaaaatcttggtatgtgaaaaggtgtgccaagcaaactttagatgcttc       c.*1020

          .         .     | 11   .         .         .         .    g.30138
 ctcagctatatcaaagctaaattg | ctctagcaacatcttcacatcccaagcatccttttc    c.*1080

          .         .         .         .         .         .       g.30198
 ttcatttgggtaactttttgccatgttgtagtgcttttcaccaggttttacctcttgtgg       c.*1140

          .         | 12         .         .         .         .    g.32190
 agacttgagaatgcgaat | ctgctctatctgtattccatagcctttaaaacctgcattatc    c.*1200

          .         .         .         .         | 13         .    g.35022
 ccatgaagtgttccgatagatgtcatcaactctgtcaattagctctat | taagtaatttgt    c.*1260

          .         .         .         .         .         .       g.35082
 agttgtactctcttcccctctgcccatgtatctgtagaagcgatgatctgctaccaccaa       c.*1320

          .         .         .         .         .         .       g.35142
 taatttacacgtgttcttcatgggatctgggtcagctcttcttttcactcgatgaacaag       c.*1380

    | 14     .         .         .         .         .         .    g.36743
 ct | cttcaggtggttctctgtctactaacccttttgggagcaactcttcattatccacttt    c.*1440

          .         .         .         .         .         .       g.36803
 taaataaccacacacttttggagactgcaaacgtgaaacattcttgatatcttcagattt       c.*1500

          .         .         .         .         .  | 15      .    g.44742
 ataaactaacattcttttgtctttggtatcattaacaaatctccaaagtgg | ctctatgtt    c.*1560

          .         .         .         .         .         .       g.44802
 atattcggccccatctgtgttgattctgattataacatcatcatctcttatgtgggctag       c.*1620

          .         . | 16       .         .         .         .    g.45637
 aaccctagagtcaggctcac | caaccacgtgtccagtgaagaagtcctgccattttacagt    c.*1680

          .         .         .         .         .         .       g.45697
 gtactcgctttcgtttttaccatccaccaccacgaccttgaaattttgtgaaaaacgttc       c.*1740

          .         .         .  | 17      .         .         .    g.52081
 agtacttgatgtcaggtataatttaaaatgc | cttttcaaagctgaaaaagttagtagtgt    c.*1800

          .         .         .         .         .         .       g.52141
 ttctacatgtgttgaagtctgtagatctctttttcttaccgaatgctgctggatattaga       c.*1860

          .         .         .         .     | 18   .         .    g.64424
 taaagagagaatatcgtagtctgagagcaaagaatcaagcttct | cgagtctctggtgggg    c.*1920

          .         .         .         .         .         .       g.64484
 gccgaagcccgggtcatccggaggtcgcggcgccagcacgaaaggaaccacgctggtcag       c.*1980

          .         .         .         .         .         .       g.64544
 gaataggagagactgcctcatgttcccggccccgctaccgactccacctctctgggcagc       c.*2040

          .         .         .         .         .         .       g.64604
 cttcgcctgacggggtttcggaaaactgctcacatcgggggaggacgggatccgcccggc       c.*2100

          .         .         .         .         .         .       g.64664
 ctagcccctcaatcctcttttccctcccgcgccgcctactgggaagattctaccgccagg       c.*2160

          .         .     | 19   .         .         .         .                                       g.64724
 ctcgacgcccccagaagtgcaggt | g                                       c.*2185

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The ADAM metallopeptidase domain 17 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.