ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13) - 1000 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.25088
gtaggcggcctccctcggggcagaggctgggcttcccccagcctccaagatggccacagc  c.1705+60

         .         .         .         .         .         .  g.25148
ccagagcgttggtgcaggggctgctcaggtcacagggcctgcacactcactcagccctgg  c.1705+120

         .         .         .         .         .         .  g.25208
atgcctcctgtggtgtcagcgtctccctcttccacttcgccacccttctgtggcaggctc  c.1705+180

         .         .         .         .         .         .  g.25268
aggttttggccttgatgctgctgggactgtggtgcctcagtaatggtcactcactgtagc  c.1705+240

         .         .         .         .         .         .  g.25328
cgtgctgcaaaaaaaacacagacattggccgggcgctgtgctcacgcctgtactcccggc  c.1705+300

         .         .         .         .         .         .  g.25388
actttgggaggctgaggcgggtggatcacctgtagtcgggagatcacctacagcctggcc  c.1705+360

         .         .         .         .         .         .  g.25448
agtatggtgaaaccccatctctactaaaaatacaaaaattagctgggcatgatggcgggc  c.1705+420

         .         .         .         .         .         .  g.25508
gcctgtagtcctagctactcaggaggctgaggcaggagaattgcttgaacccaggaggca  c.1705+480

         .         .  g.25528
gaggttgcagtgagccgaga  c.1705+500

--------------------- middle of intron ---------------------
                            g.25529     .         .           g.25548
                            c.1706-500  tccctctgcactccagcccg  c.1706-481

.         .         .         .         .         .           g.25608
ggcaacagagtgagacactgtctcaaaaaaaaaaaaaaaaaaagtatggacgttgtgcat  c.1706-421

.         .         .         .         .         .           g.25668
tctgtggcagctaccctcttctctcctgctcaagaaatcccactgagagggacacaagtg  c.1706-361

.         .         .         .         .         .           g.25728
aatgagagggatggtagttacatttggaaaatctttgactttggtgtatatatgaggtca  c.1706-301

.         .         .         .         .         .           g.25788
aaaaccatttgcaaatgccagtgcttctatggagagcagagacttgagccctgcctccct  c.1706-241

.         .         .         .         .         .           g.25848
ctggcttgccccactgtgctggagaaccttggacccggtcccttctcccagccagggcag  c.1706-181

.         .         .         .         .         .           g.25908
agccttggcaggtggtcctccagcctgcttttaattgcccccatgacaggggactcactg  c.1706-121

.         .         .         .         .         .           g.25968
ctgctggagccagccccatggcattgttcaatttttcccgaccagctaagatcagctccc  c.1706-61

.         .         .         .         .         .           g.26028
tttgtctgtggtgtggtggctgtgaggtccacgcatctctccttcttttcttctttctag  c.1706-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center