ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13) - 632 nt intron 18 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.29466
gtgagtgtggtgctgtctgcgcagctccaagggggagagagggttccgctggggctgctg  c.2234+60

         .         .         .         .         .         .  g.29526
ggctctgtccctggcctatggggcccatgtggcagggccgggctgagctgctcctgtgca  c.2234+120

         .         .         .         .         .         .  g.29586
ggctctcattacccctgcccacagccctgcaaggggggctctgtgagtgcccccattctg  c.2234+180

         .         .         .         .         .         .  g.29646
caggtgaggacactgaggcttggggcagacatggtgacaatgtcagcccagtgggaccca  c.2234+240

         .         .         .         .         .         .  g.29706
cacctgctgccaccttgtctgggccaccgaggcctctcttgagctcaggtactcatggtg  c.2234+300

         .        g.29722
agatggaggtgattgc  c.2234+316

--------------------- middle of intron ---------------------
                                g.29723           .           g.29738
                                c.2235-316  ctacctggagggttgt  c.2235-301

.         .         .         .         .         .           g.29798
agggagacttgcggagctcctggtgcaaagcccctggctgtcaccacacctgacggggca  c.2235-241

.         .         .         .         .         .           g.29858
cactgttagggacgaggccattcctgctgggtgcaggacagggcagctgctcaccagcct  c.2235-181

.         .         .         .         .         .           g.29918
gtgattcggttgtcctcaggctcagccgtctggcagcctgggaacacctggagaggctag  c.2235-121

.         .         .         .         .         .           g.29978
gctggccgtagtgcccattgcttgtcccagaccgggggagtacatcagcacctgccaccc  c.2235-61

.         .         .         .         .         .           g.30038
catcaccccaggccagcctgggacctggccagggtcccgacgctctgtctccttcctcag  c.2235-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center