adenosine deaminase (ADA) - coding DNA reference sequence

(used for mutation description)

(last modified April 25, 2014)

This file was created to facilitate the description of sequence variants in the ADA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000020.10, covering ADA transcript NM_000022.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTGCAGAGGCTGAAGGTGGCATCCCATAGGCTTTATAGAGCAGGTCGAGAAGCTCCCTCT       c.60
 L  Q  R  L  K  V  A  S  H  R  L  Y  R  A  G  R  E  A  P  S         p.20

          .         .                                           g.84
 TTTCATCTTCTGGGAGGAAACTAG |                                        c.85
 F  H  L  L  G  G  N  X                                          p.27

          .          | 02        .         .         .         .    g.760
 atttggccgcattgatgtt | cagccttttaaactcctcttcagtaaagcccatgtcccgtt    c.*60

          .         .         .         .         .         .       g.820
 tggtcatctggtaatcagtgtccagggtggacttgaagatgagcgggtcatctgtgttga       c.*120

          .         .          | 03        .         .         .    g.2320
 gcgagtagttagcctggtcatttttgagc | cgaatgactgcatgctccgtgtccggcttcc    c.*180

          .         .         .     | 04   .         .         .    g.2556
 aggcaccagtgaggtagctggaccaggggcagat | ctcgaagtgcatgttttcctgccgca    c.*240

          .         .         .         .         .         .       g.2616
 gcctgttataaagggcctggtcttccagggtgtggtagccgtgtcccagccgctctgtct       c.*300

          .       | 05 .         .         .         .         .    g.2752
 tgagtatgtccacagc | ctcttttactacttcggccgagcccacctccccggcgtggacag    c.*360

          .         .         | 06         .         .         .    g.3935
 tacggtgaatgccgctcttcacagcctc | ctggtaggcctggacatgtccaggcaagaggc    c.*420

          .         .         .         .         .         .       g.3995
 tgcttcctgggatggtctcatctccagccaggtcaatggctaccacggtctgctgctggt       c.*480

          .         .         .       | 07 .         .         .    g.5294
 acttcttacacagctccaccaccttgggggaccagt | tgggctggtggcgcatgcagcaca    c.*540

          .         .         .         .         .         .       g.5354
 ggatggaccgggccttgaccccgaagtctcgctccccctcctgcaggccctggcccacta       c.*600

          .         .         .   | 08     .         .         .    g.6185
 gggccaccacctcgtctggggtgaggtcccct | tcagcctggttccaggggattggctcca    c.*660

          .         .         .         .         .         .       g.6245
 ctttggagttggccagcaggtgcggactgtaccgcacctccacatacaccacgccctctt       c.*720

          .         .         .         .         .       | 09 .    g.8752
 tggccttcatctctacaaactcataggcgatccttttgatagcctcccggcagccc | gcga    c.*780

          .         .         .         .         .         .       g.8812
 tagcaggcatgtagtagtcaaacttggccaggaagtctggaagggtgagcggcttgtcca       c.*840

          .         .         .         .         .          | 10    g.15929
 tgccaatgacgttcagcagcccctctgctgtgttagctgggagggcgatccctctcctc | c    c.*900

          .         .         .         .         .         .       g.15989
 tgccatagtataagatggtttcaggcttgatggatccgtctaggtggacatgcagttcca       c.*960

   | 11      .         .         .         .         .         .    g.31335
 c | tttgggcttgtcgaaggcgggcgtctgggccatggtgccctcgtgcgccccggcgctgc    c.*1020

          .         .         .         .         .         .       g.31395
 tccctccgccgccgctcggtgggtctctgccggctcggtggccgctcggctttccctggg       c.*1080

          .         .         .         .   | 12     .         .                     g.31455
 gccagcggtggccgcggccggccacgctcttcttaacgggcc | c                     c.*1123

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Adenosine deaminase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.