adenylate kinase 2 (AK2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the AK2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering AK2 transcript NM_001625.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 GTCATCTTTCATGGGCTCTTTTGGAGGGTTGAACTCCTCGTGGTAGGAACGGCCACTCTT       c.60
 V  I  F  H  G  L  F  W  R  V  E  L  L  V  V  G  T  A  T  L         p.20

          .    | 02    .         .         .         .         .    g.6892
 GGGGTGAATCAGC | CTTCCTGTGATTCTTCGGATCAGCAGAGAGTCTGGGATGCTGAATTC    c.120
 G  V  N  Q  P |   S  C  D  S  S  D  Q  Q  R  V  W  D  A  E  F      p.40

          .         .         .         .         | 03         .    g.7083
 AATCACAGAATCAAGCTTCTCTTTCCTCTTCTCCATGAGGTCATCGAG | CATTTCTGCCTG    c.180
 N  H  R  I  K  L  L  F  P  L  L  H  E  V  I  E   | H  F  C  L      p.60

          .         .         .         .         .         .       g.7143
 CCTCACAGTCCGAGGGAAGCCATCCAGAAGAAAACCATTTTTGCACAAGGGGGTCTCCAA       c.240
 P  H  S  P  R  E  A  I  Q  K  K  T  I  F  A  Q  G  G  L  Q         p.80

          .         .         .          | 04        .         .    g.9941
 ATTCTTCTCAATGAGCTCCACTACCATTTCATCACTCAC | CAGTTTCCCAGCATCCATAGT    c.300
 I  L  L  N  E  L  H  Y  H  F  I  T  H   | Q  F  P  S  I  H  S      p.100

          .         .                                               g.9962
 TGCCTTCAGCTTTTTTCCTAG                                              c.321
 C  L  Q  L  F  S  X                                                p.106

          .         .         .         .         .         .       g.10022
 ctctgagccagaagccaccatggccctcagcatgtccccagtagctaaatggcagacaca       c.*60

          .         .     | 05   .         .         .         .    g.22250
 gaagttttcagccaatctgggtgc | ctgggtccctttaccggccccgggaggccccagcag    c.*120

          .         .         .         .         .         .       g.22310
 cacggcccggatgcctttaggatactcgggttctgccgctggcacgctgggagccatgtc       c.*180

          .         .         .         .         .         .       g.22370
 cgccgaagtctctcactgccaccagttcgcacgcctcacaggtccagtgcttcccaggtc       c.*240

          .         . | 06       .         .         .         .                                           g.22430
 aacgcacgcacgccacgcac | t                                           c.*261

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Adenylate kinase 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.