biogenesis of lysosomal organelles complex-1, subunit 3 (BLOC1S3) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the BLOC1S3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering BLOC1S3 transcript NM_212550.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.1036
                         gaaatcacagcccttcagctgccacggtgagaacgc       c.-61

 .         .         .         .         .         . | 02           g.1552
 agcactcgggttaggaagcggatctcgcaagctccgagcgtcagctgccgg | ttcggtgcc    c.-1

          .         .         .         .         .         .       g.1612
 ATGGCGTCCCAGGGTCGTCGGCGGAGGCCCCTGCGGAGGCCGGAGACGGTGGTGCCGGGG       c.60
 M  A  S  Q  G  R  R  R  R  P  L  R  R  P  E  T  V  V  P  G         p.20

          .         .         .         .         .         .       g.1672
 GAGGCGACCGAGACGGATTCCGAGCGCTCTGCGTCCTCGTCGGAGGAGGAGGAGCTGTAC       c.120
 E  A  T  E  T  D  S  E  R  S  A  S  S  S  E  E  E  E  L  Y         p.40

          .         .         .         .         .         .       g.1732
 CTGGGTCCTTCGGGCCCGACGCGCGGCCGCCCCACGGGGCTGCGGGTGGCTGGGGAAGCC       c.180
 L  G  P  S  G  P  T  R  G  R  P  T  G  L  R  V  A  G  E  A         p.60

          .         .         .         .         .         .       g.1792
 GCGGAGACCGACTCGGAGCCGGAGCCGGAGCCGGAACCGACGGCCGCGCCGAGGGACCTG       c.240
 A  E  T  D  S  E  P  E  P  E  P  E  P  T  A  A  P  R  D  L         p.80

          .         .         .         .         .         .       g.1852
 CCTCCACTCGTGGTGCAGCGGGAATCGGCGGAGGAGGCCTGGGGCACGGAGGAGGCCCCG       c.300
 P  P  L  V  V  Q  R  E  S  A  E  E  A  W  G  T  E  E  A  P         p.100

          .         .         .         .         .         .       g.1912
 GCGCCCGCCCCCGCGCGCTCGCTCCTGCAACTTCGGCTGGCGGAGAGCCAGGCGCGGCTG       c.360
 A  P  A  P  A  R  S  L  L  Q  L  R  L  A  E  S  Q  A  R  L         p.120

          .         .         .         .         .         .       g.1972
 GACCACGACGTGGCGGCCGCCGTGAGCGGTGTCTACCGCCGTGCAGGCCGCGACGTGGCC       c.420
 D  H  D  V  A  A  A  V  S  G  V  Y  R  R  A  G  R  D  V  A         p.140

          .         .         .         .         .         .       g.2032
 GCCCTGGCTAGTAGGCTGGCGGCAGCCCAGGCGGCGGGGCTGGCGGCGGCCCACAGCGTG       c.480
 A  L  A  S  R  L  A  A  A  Q  A  A  G  L  A  A  A  H  S  V         p.160

          .         .         .         .         .         .       g.2092
 CGCCTGGCGCGCGGGGACCTTTGTGCGCTGGCCGAGCGTCTGGACATCGTGGCTGGCTGC       c.540
 R  L  A  R  G  D  L  C  A  L  A  E  R  L  D  I  V  A  G  C         p.180

          .         .         .         .         .         .       g.2152
 CGCCTGCTGCCGGACATCCGCGGCGTGCCAGGGACCGAGCCTGAGAAAGACCCGGGGCCG       c.600
 R  L  L  P  D  I  R  G  V  P  G  T  E  P  E  K  D  P  G  P         p.200

                                                                    g.2161
 CGGGCCTAG                                                          c.609
 R  A  X                                                            p.202

          .         .         .         .         .         .       g.2221
 ccatgattctacttcccaacctgactgcaatttgggggtaggccttgctgcctctgggac       c.*60

          .         .         .         .         .         .       g.2281
 ctgactctgtctcctgtgtctcttatcaccccccacccccgctcccatcttggtgtcacc       c.*120

          .         .         .         .         .         .       g.2341
 catgggggctaatccggtccccttggataatgctttatattggatatagttcaaccccta       c.*180

          .         .         .         .         .         .       g.2401
 ctgcggagaccagggccccactatccttagatctggttcctctcccgatcctgaccctgc       c.*240

          .         .         .         .         .         .       g.2461
 cgcctggttctgagccttcccctggggcttggctccagcctttgttacatagttgctcct       c.*300

          .         .         .         .         .         .       g.2521
 taatctgtttccaccctgggggctcaccaattttttttttttttttttttttttggagac       c.*360

          .         .         .         .         .         .       g.2581
 agggtgtttatctgtcacccaggctagagtgcagtggcgggattactgctcactgcaacc       c.*420

          .         .         .         .         .         .       g.2641
 tcgacctcctgggctcaagtgatcctcccagctcagccttcaagagtagctgggactgca       c.*480

          .         .         .         .         .         .       g.2701
 gacctgcaccaccacgtccagctgcccggttaatttttttctgtcggtttgaagagggga       c.*540

          .         .         .         .         .         .       g.2761
 gaaggtctcactatgttgcccaggcttgtctcaaactcccgggctcaagcaatcctccca       c.*600

          .         .         .         .         .         .       g.2821
 ctgtggcgtcccaaagtgctggggttacaggtgtgagccaccacacactgggctctgctc       c.*660

          .         .         .         .         .         .       g.2881
 tgcctttctgagtttggtttctgcttatggtggggagcttgttcccgttcttcccacaag       c.*720

          .         .         .         .         .         .       g.2941
 aacccaggatgtggcacagcttccctgccgtcttccttcactcagttggctacgcctccc       c.*780

          .         .         .         .         .         .       g.3001
 atcctagctccacttccagaactgccttcaccctaggctgggtccttgttttgtttttag       c.*840

          .         .         .         .         .         .       g.3061
 agacagggtctcactgtgtctcccaggctggagtacagtggcgtgatctcggctcactgc       c.*900

          .         .         .         .         .         .       g.3121
 cacctccacctcccgagttcaagcgattctcctgcctcagcctcccgagtagctaggatt       c.*960

          .         .         .         .         .         .       g.3181
 acaggcatgcaccaccacgcctggctactttttatatttttagtagagatgaggtttcac       c.*1020

          .         .         .         .         .         .       g.3241
 cttgttggccaggctggtctcgaactcctggcctcaggtgatccacccgcctcacctcct       c.*1080

          .         .         .         .         .         .       g.3301
 aaaatgctgggattacaggcgtgggccactgcgcctagccagctgggtccttgttctgct       c.*1140

          .         .         .         .         .         .       g.3361
 gcccaagcttggccctggttccgtgtgctggttctactttttgttctcccatctgcctcc       c.*1200

          .         .         .         .         .         .       g.3421
 tgcctcctcccctttgagcttagccccgccctctcagcctgatttctgtttcccaagtcc       c.*1260

          .         .         .         .         .         .       g.3481
 agcagtgtcgtgggataggttttgctttcttttactgtctccatcctacttacacctccc       c.*1320

          .         .         .         .         .         .       g.3541
 tgatcctggggtctggggactccccatggtttccttccttctgcaggcccaaaatgatgg       c.*1380

          .         .         .         .         .         .       g.3601
 cccctcttaacccaaggcaggggatcttcctcccaactccctggaccaaggtggcatttc       c.*1440

          .         .         .         .         .         .       g.3661
 ctgcacacccctccaggccaagatgatgctcgctctcaactctgtaggccaaggtggcgt       c.*1500

          .         .         .         .         .         .       g.3721
 ctcctcttgactctccagacctaaagtgacacccttcaggcacttcgggcccaattcagc       c.*1560

          .         .         .         .         .         .       g.3781
 ccagtcctggtgctttcagcgccagatgacagcactttgcagataagaacgatatgatgt       c.*1620

          .         .         .         .         .         .       g.3841
 gtggatttcactacatttggctcctggatgctataaaaggacttggatttctgacttggc       c.*1680

          .         .         .         .         .         .       g.3901
 tcagggactggggttagcagtctctttctgctccttttcacctgtgttttcttccgatcc       c.*1740

          .         .         .         .         .         .       g.3961
 cagctctggtccctcagccgcattcatatttactctcctctcccagcctgatatccctgt       c.*1800

          .         .         .         .         .         .       g.4021
 ccctcatctcaacccgaagccaagatctgagcccccaagatggagaatggggaggagctt       c.*1860

          .         .         .                                     g.4056
 tttatggcggactgattaaaactcttaagcattta                                c.*1895

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Biogenesis of lysosomal organelles complex-1, subunit 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.