complement component 1, q subcomponent, B chain (C1QB) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)


This file was created to facilitate the description of sequence variants in the C1QB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering C1QB transcript NM_000491.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.1012
                                                 gcccttcccgcc       c.-121

 .         .         .         .         .         .                g.1072
 tctggggaagggaacttccgcttcggaccgagggcagtaggctctcggctcctggtccca       c.-61

 .         .         .         .         .   | 02     .             g.7268
 ctgctgctcagcccagtggcctcacaggacaccagcttcccag | gaggcgtctgacacagt    c.-1

          .         .         .         .         .         .       g.7328
 ATGATGATGAAGATCCCATGGGGCAGCATCCCAGTACTGATGTTGCTCCTGCTCCTGGGC       c.60
 M  M  M  K  I  P  W  G  S  I  P  V  L  M  L  L  L  L  L  G         p.20

          .         .         .         .         .         .       g.7388
 CTAATCGATATCTCCCAGGCCCAGCTCAGCTGCACCGGGCCCCCAGCCATCCCTGGCATC       c.120
 L  I  D  I  S  Q  A  Q  L  S  C  T  G  P  P  A  I  P  G  I         p.40

          .         .         .         .         .         .       g.7448
 CCGGGTATCCCTGGGACACCTGGCCCCGATGGCCAACCTGGGACCCCAGGGATAAAAGGA       c.180
 P  G  I  P  G  T  P  G  P  D  G  Q  P  G  T  P  G  I  K  G         p.60

         | 03.         .         .         .         .         .    g.8676
 GAGAAAG | GGCTTCCAGGGCTGGCTGGAGACCATGGTGAGTTCGGAGAGAAGGGAGACCCA    c.240
 E  K  G |   L  P  G  L  A  G  D  H  G  E  F  G  E  K  G  D  P      p.80

          .         .         .         .         .         .       g.8736
 GGGATTCCTGGGAATCCAGGAAAAGTCGGCCCCAAGGGCCCCATGGGCCCTAAAGGTGGC       c.300
 G  I  P  G  N  P  G  K  V  G  P  K  G  P  M  G  P  K  G  G         p.100

          .         .         .         .         .         .       g.8796
 CCAGGGGCCCCTGGAGCCCCAGGCCCCAAAGGTGAATCGGGAGACTACAAGGCCACCCAG       c.360
 P  G  A  P  G  A  P  G  P  K  G  E  S  G  D  Y  K  A  T  Q         p.120

          .         .         .         .         .         .       g.8856
 AAAATCGCCTTCTCTGCCACAAGAACCATCAACGTCCCCCTGCGCCGGGACCAGACCATC       c.420
 K  I  A  F  S  A  T  R  T  I  N  V  P  L  R  R  D  Q  T  I         p.140

          .         .         .         .         .         .       g.8916
 CGCTTCGACCACGTGATCACCAACATGAACAACAATTATGAGCCCCGCAGTGGCAAGTTC       c.480
 R  F  D  H  V  I  T  N  M  N  N  N  Y  E  P  R  S  G  K  F         p.160

          .         .         .         .         .         .       g.8976
 ACCTGCAAGGTGCCCGGTCTCTACTACTTCACCTACCACGCCAGCTCTCGAGGGAACCTG       c.540
 T  C  K  V  P  G  L  Y  Y  F  T  Y  H  A  S  S  R  G  N  L         p.180

          .         .         .         .         .         .       g.9036
 TGCGTGAACCTCATGCGTGGCCGGGAGCGTGCACAGAAGGTGGTCACCTTCTGTGACTAT       c.600
 C  V  N  L  M  R  G  R  E  R  A  Q  K  V  V  T  F  C  D  Y         p.200

          .         .         .         .         .         .       g.9096
 GCCTACAACACCTTCCAGGTCACCACCGGTGGCATGGTCCTCAAGCTGGAGCAGGGGGAG       c.660
 A  Y  N  T  F  Q  V  T  T  G  G  M  V  L  K  L  E  Q  G  E         p.220

          .         .         .         .         .         .       g.9156
 AACGTCTTCCTGCAGGCCACCGACAAGAACTCACTACTGGGCATGGAGGGTGCCAACAGC       c.720
 N  V  F  L  Q  A  T  D  K  N  S  L  L  G  M  E  G  A  N  S         p.240

          .         .         .         .                           g.9198
 ATCTTTTCCGGGTTCCTGCTCTTTCCAGATATGGAGGCCTGA                         c.762
 I  F  S  G  F  L  L  F  P  D  M  E  A  X                           p.253

          .         .         .         .         .         .       g.9258
 cctgtgggctgcttcacatccaccccggctccccctgccagcaacgctcactctaccccc       c.*60

          .         .         .         .         .         .       g.9318
 aacaccaccccttgcccaaccaatgcacacagtagggcttggtgaatgctgctgagtgaa       c.*120

          .         .         .                                     g.9348
 tgagtaaataaactcttcaaggccaaggga                                     c.*150

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Complement component 1, q subcomponent, B chain protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center