(intronic numbering for coding DNA Reference Sequence)
. . . . g.20770
ctgccagggagagaaaggatccgggcaagtgtgtgtgcaacaggctac c.2267+48
--------------------- middle of intron ---------------------
g.20771 . . . . g.20817
c.2268-47 ctaccccctggcagcctccaagaagcctctgccaccccgggacccac c.2268-1
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center