(intronic numbering for coding DNA Reference Sequence)
. . . . . g.35623
ctgtgatgtggggtgcaggtgggggaagttcaggcaggctcagggctgtgg c.3731+51
--------------------- middle of intron ---------------------
g.35624 . . . . . g.35673
c.3732-50 ccggtgtccccgaagggaggagtgggaccccttcccgccccgggtctcac c.3732-1
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center