complement component 8, beta polypeptide (C8B) - coding DNA reference sequence

(used for mutation description)

(last modified April 29, 2014)


This file was created to facilitate the description of sequence variants in the C8B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering C8B transcript NM_000066.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .         .         .       g.60
 TCTTCCGATAGGAGACCTCACAGGCTAGGCCTTGGGATCCAACAGGACAGATGCAGTCAC       c.60
 S  S  D  R  R  P  H  R  L  G  L  G  I  Q  Q  D  R  C  S  H         p.20

           | 02        .         .         .         .         .    g.1576
 AGCGTGATC | CTTTCAGGACAGGGACTCCATTTCCTTGGCAGGGAGCACAGTGGCAGGAAC    c.120
 S  V  I   | L  S  G  Q  G  L  H  F  L  G  R  E  H  S  G  R  N      p.40

                                                                    g.1579
 TAA                                                                c.123
 X                                                                  p.40

          .         .         .         .         .         .       g.1639
 cttccttctggaactcctccagtgcctgcttcatgttctgcctcactgtgctggaatagg       c.*60

          .         .         .         . | 03       .         .    g.9059
 caaaatctgtggctgtcactagttcatacagaggctccac | cttaactttgatgatggctg    c.*120

          .         .         .         .         .         .       g.9119
 ggttgtactgcacagcgtctccccactcctgcatcaggtccgccgtcggcagctcctggt       c.*180

          .         .         .         .         .         .       g.9179
 atgccagggtggtgatgtgctcacttgcccctcctcgtaccaggaccaccaagtcctcca       c.*240

          .         .     | 04   .         .         .         .    g.11922
 ccatggtgtccctcttgtttctgt | cttttatttcattcagaatacctctgcatttgccta    c.*300

          .         .         .         .         .         .       g.11982
 cagacacacccagactgacgtagacctcttcaatggcaccaccaattttaaaatcatttt       c.*360

          .         .         .    | 05    .         .         .    g.14038
 tggcacaggcatggacgttgttaagagtataat | ctcctctctccatggcctctttgttca    c.*420

          .         .         .         .         .         .       g.14098
 taacgagggtgtattcataaatgcccccaagcacagcctctgtgatgtagtgggtcccaa       c.*480

          .         .         .         .         .         .       g.14158
 aatcacggaagagatctctgtattccccgtagctgtactccaggggcagccgcttaactc       c.*540

          .         .         .         .         .         .       g.14218
 tctgaaggaactcgtaatggagcatgaggcttctgggtttcagcttgtaatgtgctactt       c.*600

          .         .         .     | 06   .         .         .    g.17771
 caaggtcagagcgtgcatgcagaaatacgctttt | agtatgagagaatcgtttggttctcc    c.*660

          .         .         .         .         .         .       g.17831
 taatatagtgtttgcctcgatcactttgactactgatgccaagttcaaatattccaggta       c.*720

          .         .         .         .         .         .       g.17891
 ttttaaaaccaaaactgaaaccagacttgcttgccattttctctgtgacattgcgttcaa       c.*780

          .         .         .         .         .   | 07     .    g.20246
 aatctgagtatgattcatactcttttaatatgaattcgtatttgccttgggt | ctgtggcg    c.*840

          .         .         .         .         .         .       g.20306
 tgtagctttccacattgtagggcttcctaaacctcgtgttcaggatgtaatgcggggagc       c.*900

          .         .         .         .         .         .       g.20366
 atccacctgcataatacctgtgatcaagaactgggccctcaaaactgtttgtgaacaaat       c.*960

       | 08  .         .         .         .         .         .    g.22931
 ttatc | ccactggccagactgccaattccccagtattggtccatttcatgctgacattttt    c.*1020

          .         .         .         .         .         .       g.22991
 tataaatccttctacagtttgcttcatctgactggtctccacagtcattgtccccattgc       c.*1080

          .         .        | 09.         .         .         .    g.24992
 aaagaagtctgcggtttacacaccttc | ctgtctgtgcacacacaaagccttcacatcgca    c.*1140

          .         .         .         .         .         .       g.25052
 cttgacttccgcatggtctgttggtaacacagtcttcgacttccttgtcagagaagttgc       c.*1200

          .         .         .         .          | 10        .    g.28221
 acggttccccatggaactgagagggctggagcaagtaggcatacctgta | ccttttcttct    c.*1260

          .         .         .         .         .         .       g.28281
 gacaggggtcacatgtggtccaagaggaccaactagacagctcacaatcaatgggcatca       c.*1320

          .         .         .         .         .         .       g.28341
 gggtaacatccacactccgcatctgtctgctcttagcaaagctcttgttgactgcatttg       c.*1380

          .         .       | 11 .         .         .         .    g.34081
 acccaaaggaatgtggcctttcacct | ctggagccaggcaaactgagacagcccagggcag    c.*1440

          .         .         .         .         .         .       g.34141
 cacagagaagaaatagctccaccggcgccctccaagcccatgtcctggaattcttcattt       c.*1500

          .         .         .         .         .         .       g.34201
 tcccaatgtgacaggagatgccacagaggctgctagacccataacaagcctgtgctgtga       c.*1560

          .         .         .         .         .         .       g.34261
 gtgccactgtcagcttctgtccccaagagcaaatagctctgcaaagtaaacagaaagcca       c.*1620

          .         .         .         .         .         .       g.34321
 ctagtgactggaaacagactttgcacagaccaaaaacttacctgtcactctggaaaccaa       c.*1680

          . | 12       .         .         .         .         .                                                     g.34381
 ccagaataat | c                                                     c.*1691

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Complement component 8, beta polypeptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center