complement component 9 (C9) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the C9 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000005.9, covering C9 transcript NM_001737.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .                                               g.24
 CTTCAGAAATTTTTTGTTTACTGA                                           c.24
 L  Q  K  F  F  V  Y  X                                             p.7

          .         .         .         .         .         .       g.84
 tttcacaggcaattccctcaaatttgaatgggcaggcacacaaacactttccatccatta       c.*60

          .         .         .         .         .         .       g.144
 gaatcactgtacctccattttggcatgtgtggcattttcttacactaaattcattgatat       c.*120

          .         .         .         .         .         .       g.204
 agtcttcaatggctctttccaagttttgtttctttaggtgtgcatttttcattttcactg       c.*180

          .         .      | 02  .         .         .         .    g.17929
 gaaccagattatatataggagacag | tttttgactaatgagaacaggagcatcatttatgg    c.*240

          .         .         .         .         .         .       g.17989
 aagaggcccagttgacaaagtcagtcacatcaatcacggttcctcggagaagcttttctt       c.*300

          .         .         .         .         .         .       g.18049
 tcagttcaaatgcatattttctggttccacctcttatgagtgaaacaacatcatctatga       c.*360

          .         .  | 03      .         .         .         .    g.19546
 ggttttcactggtgatgttta | cagctctaccctctcccctctttacacaatcatctttat    c.*420

          .         .         .         .         .         .       g.19606
 taaattcagctccaacagagatttcagagaaagccagagatacatccagatgatacccaa       c.*480

          .         .         . | 04       .         .         .    g.22444
 ggcatctctttatgtcttttagttcaacac | ctttccgcttcatggaagctttatccaaaa    c.*540

          .         .         .         .         .         .       g.22504
 catatattagttcatagagtcctcctagagacccagagctactgtagtgagttccatagg       c.*600

          .         .         .         .         .         .       g.22564
 tttccaaaaaggcaaaatattctcccttttcataggtagttggcaaagcttttatatcat       c.*660

          .         .         .         .         .         .       g.22624
 ccacaaaagttgttgtgagcacaacatcgcgatttctcattacaaatcttcccagatgaa       c.*720

          .         .         .  | 05      .         .         .    g.27081
 tttctcctttcacatgcagaaacattttttc | cttctttgaagaatatgacaaaaatagtt    c.*780

          .         .         .         .         .         .       g.27141
 ggtaagtttcatttttggaatatgaaaaccgaaaactacccttgccatgtaaagaaattg       c.*840

          .         .         .         .         .         .       g.27201
 aggaggctgtttcctcacaacattgttcagctttatttgtttcagtgggtgtaaatttta       c.*900

          .         .         .         .         .         .       g.27261
 gagatatagctgcattaaaatttgatgtcttctcttggatgatacttttaaatgcttcaa       c.*960

          .         .         .         .       | 06 .         .    g.42967
 tttgttcttcgtaatgttcggttctgaaatttttctcgcctttggt | ttcatagatcaaag    c.*1020

          .         .         .         .         .         .       g.43027
 aagccacgttccaaggtcttcggtagtatgtcagagtgtttccatcccgatcccggttac       c.*1080

          .         .         .         .         .         .       g.43087
 agagtccattgtagaactcattgtcaaaaggtgtgcttaggggatccatccctaaaatgt       c.*1140

       | 07  .         .         .         .         .         .    g.52478
 tgatc | ccatagcctgctgttcgtgccagctcagactcttctaccactctgtctctgcagg    c.*1200

          .         .         .         .         .         .       g.52538
 ggggacggggctcactttcacaatcatcctcatctgaaaagtctccgcagtcattgtcac       c.*1260

          .         .         .    | 08    .         .         .    g.52860
 cattacaccgaagtcgcatctttatgcatctgc | ctgtactgcattgaaagtcatttccgc    c.*1320

          .         .         .         .         .         .       g.52920
 agtcatcctcagcatcctcacagggctctgtgggcacacactgtcgtctgtctcccacag       c.*1380

          .         .         .         .         .         | 09    g.53370
 cgtcggtgcatcttttcccattaaattgtccaaagacctcaatgcttcttgaacgaaa | ca    c.*1440

          .         .         .         .         .         .       g.53430
 tttgtctgagacaaggatcgcattgtgaccattcactccaggggctcattctgcagtcta       c.*1500

          .         .         .         .     | 10   .         .    g.75681
 tgtgtgatgcagagccactgctttctgttagctctgggtcataa | ctggtcgtgtactgtg    c.*1560

          .         .         .         .         .         .       g.75741
 ctgtgaggatgcttatttctaaaatgcagattgcaactgcaaagctccggcaggctgaca       c.*1620

          .         .         .         .         .         .       g.75801
 tgctgctcttgctgggtggctgcgagtggggtggcagggcaggtctggtaaggcatttat       c.*1680

          .         .         . | 11       .         .         .                                 g.75861
 ttgcaaagggccagaggacagggaacaagc | g                                 c.*1711

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Complement component 9 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.