caspase recruitment domain family, member 8 (CARD8) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the CARD8 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering CARD8 transcript NM_014959.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .      | 02  .         .    g.3546
 CTGAGAAAGGAGGAGGGGCTGATGCAGCTACAAGCTGGAGATCCA | CTGGCTTCACCTCAG    c.60
 L  R  K  E  E  G  L  M  Q  L  Q  A  G  D  P   | L  A  S  P  Q      p.20

          .         .         .                                     g.3582
 TATCCCACACCAAAGTCCCATGTCTTTTTTCAGTAA                               c.96
 Y  P  T  P  K  S  H  V  F  F  Q  X                                 p.31

          .         .         .         .         .         .       g.3642
 tctcaagttgaatgggttccttcatctgcccagcatagaattttgagaagtgctgaattt       c.*60

          .         .         .  | 03      .         .         .    g.6419
 ctccagggctcctgtaggacaatttcaactc | cttgggcattactttcaggttagcagaat    c.*120

          .         .         .         .         .         .       g.6479
 tagacacaatataactggaaccaaagttcaggggttccattgggggcgaagtctgcaggc       c.*180

          .         .         .        | 04.         .         .    g.15121
 gcacaccatggaagcgatcttcctcatcatctatcgc | ctttgttagcaaggcgtcgctgg    c.*240

          .         .         .         .         .         .       g.15181
 ggacaaggtacaagtggaacttaatatcttcggggtgggggtgataatagatcaatgtgt       c.*300

          .         .         .         .         .         .       g.15241
 tggaagtgatggggatggagaggcgagtcccactggcgatccgcagcaggatgcccatca       c.*360

          .         .         .         .         .         .       g.15301
 gagagaagctggggctttccaggacagcatagaaaggctccacccgggctggatgctcca       c.*420

          .         .         .         .         .         .       g.15361
 ggaccatcccttcattcttaaaatgggcaacgagaaaccaggagacgtccacctcacctg       c.*480

  | 05       .         .         .         .         .         .    g.15497
  | cttggagggagatgaagtgggggaggtggatttcggcgacagcctcctctggctctgcag    c.*540

          .         .         .         .         .         .       g.15557
 tgacatcaaacaaggggccgcccaccagccactgttcatggtgctgcaggtccagggcca       c.*600

          .         .         .         .         .         .       g.15617
 ggtgctgactccaggaaccaaacgcaatcgtcactgtgacctcatcccttaccaggaagc       c.*660

          .         .         .         .         . | 06       .    g.16330
 cgaggcctgtggctgaccacagataccagccagcagtggggaaccaaacg | ctgtatctgt    c.*720

          .         .         .         .         .         .       g.16390
 ttgtgctcttatcaatcaactcaacatccacatttccttcaggccccagaaactgacgat       c.*780

          .         .         .         .         .         .       g.16450
 ttttataatcttcttcgatctcaaaacagactttagaagcataagaggaaactatttgat       c.*840

          .         .  | 07      .         .         .         .    g.17152
 tctcttctgagcaaatgtctc | ctgaatcttgtccctctgaagattcctgctcttctgata    c.*900

    | 08     .         .         .         .         .         .    g.19121
 ca | ctgggaatgtcccccccagatagttgacactcaggaacagcacggaacaataatggct    c.*960

          .         .         .         .         .         .       g.19181
 ctgcctctgtctcatcatcttcttggaaaaaatgtgagatgtcacaaagggtctcagaaa       c.*1020

          .         .    | 09    .         .         .         .    g.25659
 cacagggtagctccctgtatacc | cgtctcggcagctcttcctcactgctgctactctttt    c.*1080

          .         .         .         .         .         .       g.25719
 ctggacactcctttttttccatttgtcaaatgtggtatttatgtctttactgtatctttt       c.*1140

       | 10  .         .         .         .         .         .    g.34238
 ttacc | attgaagatggcccagatgcttgcactaaccgcgtttaccgcccacagccatcat    c.*1200

          .         .         .         .         .       | 11 .    g.34415
 ggcgaccggaagtcctgagagcttgtttccctcgaatctcagacagccctccttct | catg    c.*1260

          .         .         .         .         .         .       g.34475
 tgagtttcaggagccccagggtgcaggaaggaggagcggaggcttgttgcttggacactg       c.*1320

          .         .         .    | 12    .         .         .                              g.34535
 ccaggctgctctgtgttctgttcctcttggtca | a                              c.*1354

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Caspase recruitment domain family, member 8 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.