caspase recruitment domain family, member 9 (CARD9) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the CARD9 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering CARD9 transcript NM_052813.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.9
 CTGCGGTAG                                                          c.9
 L  R  X                                                            p.2

          .         .         .         .         .         .       g.69
 ttctcaaaactctctttgaggcgccgccgctccttctcgggcggctccccgctgctcagg       c.*60

          | 02         .         .         .         .         .    g.710
 cctgcgtc | atgggggttccgcaaaacctgctcctggtgcagagctgcaaagggctgtttc    c.*120

          .         .      | 03  .         .         .         .    g.2352
 gggctccccccgccggcaaggcagc | ctttgtctgagagctgggtgtcctccaggtcctgg    c.*180

          .  | 04      .         .         .         .    | 05    . g.3161
 gggagtgagag | ctcctgggacctcctgggtgagccatcttccaggtcggagct | caggacg c.*240

          .         .         .         .         .         .       g.3221
 agcgtctccagctgctgccgcctgagcctgccctccacggccagtagctgcgcctcacac       c.*300

          .         .         .         .         .         .       g.3281
 tggaacacctgcagctgcagctcatccgccttctcgcccagctcccgcacctgcttgcgc       c.*360

          .         .         .         .         .         .       g.3341
 agcgcgtccttctcctgcaggccccgggcgtgctgtgcgtgcagctcctcccgcgtggct       c.*420

       | 06  .         .         .         .         .         .    g.5322
 atggc | ctggtcccgctcaatggcgacctcctccatctgcagcaggatggcctcgatgcgg    c.*480

          .         .         .         .         .         .       g.5382
 tccttgtacatcttggagtccttacgtagtgccaggcactgcagctcgaacatctccttc       c.*540

          .  | 07      .         .         .         .         .    g.5860
 tcctccatgca | ccggaggcgtcgggcctcgccctggcggaggtccttgcgcagggagaag    c.*600

          .         .         .         .         .         .       g.5920
 atggtgttggcctgctcctggtggtcccgcagcgcctgccgccagtcctcctccagtacc       c.*660

          .         .         .      | 08  .         .         .    g.6064
 tggatgtaggggctgctcctgtccagcttcccctc | ctggacggaggcctccagctcctgc    c.*720

          .         .         .         .         .         .       g.6124
 acccgggcctggagcagggccttctcctgctgcagctcccacagcagctcctggctgggc       c.*780

          .         .         .         .         .         .       g.6184
 cgctgctccatggcgtgcctgagcttcagcgtgtgcttgcgctccaccttgcagtcgtcc       c.*840

          .         .         .      | 09  .         .         .    g.6383
 tcggccttcatgaggctgtgcttgagctggtcaat | ctccagctgcaggtcacggttccgc    c.*900

          .         .         .         .         .         .       g.6443
 atgagcgcggcgcccttctcctcactctggtgcgccaggcgcatggccaggtcgtagttc       c.*960

          .         .         .         .         .         .       g.6503
 tcctccttgcagcgcttgagctcgcggctgccggcctcgcactcctccttgagcctctgc       c.*1020

          .         .         .         .         .         .       g.6563
 acacgctcctggtgcttgcgcagcaggctgtccttcacccgcagctccttgatgaagtca       c.*1080

          .         .         .         .         .         .       g.6623
 tctttggagctcagcagcgcggtcaggtcctgcaccttcttctgcagcttcatgacctca       c.*1140

          .         .         .         . | 10       .         .    g.6861
 gtcatcagcagctgagtcaggcctgactccccggacgcgt | cgatgatcatggagaagacg    c.*1200

          .         .         .         .         .         .       g.6921
 cgggccggctccttgcctgtgaccttcttgtacagctgcgggtagtagagctccaggctc       c.*1260

          .         .         .         .         .         | 11    g.7414
 tcgaggaaggccacgtagcccttgtggccggtccgctgcaggatgtccaggagcacac | cc    c.*1320

          .         .         .         .         .         .       g.7474
 actttccgtttgcggatgaccaggttggggtcgctgagcacctgctcctcatcatcgggg       c.*1380

          .         .         .         .         .         .       g.7534
 ttcaggaccttgcactgccgcaggtaaggtgtgatgcgtgaggggtcgatgaccgaggtg       c.*1440

          .         .         .         .         .         .       g.7594
 agcgtcacccggaagccctccaggacgctccagcactcgtcatcgttctcgtagtccgac       c.*1500

          .         | 12         .         .         .         .    g.9091
 atggcctcagcaggcagg | ctgagggtcttccaggagccacctgcactgcagacacaccag    c.*1560

          .         .         .         .         .         .       g.9151
 gagcctgggccgcggagcctctgggagatgctgcccggggctgcagggagggaggagcac       c.*1620

          .         .         .         .         | 13         .               g.9211
 gccggacgcctgtgcacttcctgatgggttctgcttaactccacagtc | c               c.*1669

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Caspase recruitment domain family, member 9 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.