CD247 molecule (CD247) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the CD247 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering CD247 transcript NM_198053.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .       | 02 .         .         .    g.1020
 CTGGTAAAGGCCATCGTGCCCCTTGCCCCTCCGGCG | CTCGCCTTTCATCCCAATCTCACT    c.60
 L  V  K  A  I  V  P  L  A  P  P  A   | L  A  F  H  P  N  L  T      p.20

          .         .         .    | 03    .         .         .    g.2402
 GTAGGCCTCCGCCATCTTATCTTTCTGCAGTTC | ATTGTACAGGCCTTCCTGAGGGTTCTT    c.120
 V  G  L  R  H  L  I  F  L  Q  F   | I  V  Q  A  F  L  R  V  L      p.40

           | 04        .         .         .         .         .    g.5597
 CCTTCTCTG | CGGCTTTCCCCCCATCTCAGGGTCCCGGCCACGTCTCTTGTCCAAAACATC    c.180
 P  S  L   | R  L  S  P  H  L  R  V  P  A  T  S  L  V  Q  N  I      p.60

          .         .                                           g.5618
 GTACTCCTCTCTTCGTCCTAG |                                           c.202
 V  L  L  S  S  S  X                                             p.66

           | 05        .         .         .         .         .    g.6371
 attgagctc | gttatagagctggttctggccctgctggtacgcgggggcgtctgcgctcct    c.*60

        | 06 .         .         .         .         .         .    g.7694
 gctgaa | cttcactctcaggaacaaggcagtgagaatgacaccatagatgaagaggattcc    c.*120

          .         .         .         .         . | 07       .    g.85394
 atccagcaggtagcagagtttgggatccagcaggccaaagctctgtgcct | ctgtaatcgg    c.*180

          .         .         .         .         .         .       g.85454
 caactgtgcctgcaggatggccgcggtgaaaagcgccttccacttcatcttgtcctttcc       c.*240

          .         .         .         .         .         .       g.85514
 ctcagaaagaggctgggaggcagaggctgaggcagcggtggccgggacggttaggagaaa       c.*300

          .         .         .         .         .         .       g.85574
 aggagtctctgctggttttattctgcagctacctccccaggaagtggaggactgtggggc       c.*360

          .    | 08    .         .         .         .         .                                                  g.85634
 ctttgagaaagca | a                                                  c.*374

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The CD247 molecule protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.