CD3d molecule, delta (CD3-TCR complex) (CD3D) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the CD3D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering CD3D transcript NM_000732.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .     | 02   .         .    g.340
 CTGATAGACCTGGTCATTCCTCAACAGAGCTTGTGTGTCGGCAG | CCCCAGACAGCCTTCC    c.60
 L  I  D  L  V  I  P  Q  Q  S  L  C  V  G  S  |  P  R  Q  P  S      p.20

          .         .         .         .         .         .       g.400
 AGTCTCATGTCCAGCAAAGCAGAAGACTCCCAAAGCAAGGAGCAGAGTGGCAATGACATC       c.120
 S  L  M  S  S  K  A  E  D  S  Q  S  K  E  Q  S  G  N  D  I         p.40

          .         .         .         .         .       | 03 .    g.928
 AGTGACAATGATGCCAGCCACGGTGGCTGGATCCAGCTCCACACAGCTCTGGCACA | TTCG    c.180
 S  D  N  D  A  S  H  G  G  W  I  Q  L  H  T  A  L  A  H  |  S      p.60

          .         .         .         .         .         .       g.988
 ATAATGAACTTGCACGGTAGATTCTTTGTCCTTGTATATATCTGTCCCATTACACCTATA       c.240
 I  M  N  L  H  G  R  F  F  V  L  V  Y  I  C  P  I  T  P  I         p.80

          .         .         .         .         .                 g.1042
 TATTCCTCGTGGGTCCAGGATGCGTTTTCCCAGGTCCAGTCTTGTAATGTCTGA             c.294
 Y  S  S  W  V  Q  D  A  F  S  Q  V  Q  S  C  N  V  X               p.97

          .         .         .         .         .         .       g.1102
 gagcagtgttcccaccgttccctctacccatgtgatgctggtattgcaattcacaaacac       c.*60

          .         .         .         .  | 04      .         .    g.3121
 tctgtcctcaagttcctctataggtatcttgaaggggctca | cttgcgagagaagggtagc    c.*120

          .         .         .         .         .         .       g.3181
 cagtaccaggccagagagaaacgtgctatgttccatctcccagcggaactcatccagtag       c.*180

          .         .         .         .         .         .       g.3241
 ataaagccaggtcaccgaactatcagcctgggtgagagctgccctcccctagctgactca       c.*240

          .         .         .         .         .    | 05    .          g.3301
 caggtaccggaaagaggagagtgggggaggaactagaagatgtctgcttctct | a          c.*294

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The CD3d molecule, delta (CD3-TCR complex) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.