CD3g molecule, gamma (CD3-TCR complex) (CD3G) - coding DNA reference sequence

(used for mutation description)

(last modified April 29, 2014)


This file was created to facilitate the description of sequence variants in the CD3G gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering CD3G transcript NM_000073.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.1047
                                         agtctagctgctgcacaggc       c.-61

 .         .         .         .         .         .                g.1107
 tggctggctggctggctgctaagggctgctccacgcttttgccggaggacagagactgac       c.-1

          .         .         .         .         .      | 02  .    g.5715
 ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAG | GTACT    c.60
 M  E  Q  G  K  G  L  A  V  L  I  L  A  I  I  L  L  Q  G |   T      p.20

          .          | 03        .         .         .         .    g.6467
 TTGGCCCAGTCAATCAAAG | GAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGT    c.120
 L  A  Q  S  I  K  G |   N  H  L  V  K  V  Y  D  Y  Q  E  D  G      p.40

          .         .         .         .         .         .       g.6527
 TCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGGGAAG       c.180
 S  V  L  L  T  C  D  A  E  A  K  N  I  T  W  F  K  D  G  K         p.60

          .         .         .         .         .         .       g.6587
 ATGATCGGCTTCCTAACTGAAGATAAAAAAAAATGGAATCTGGGAAGTAATGCCAAGGAC       c.240
 M  I  G  F  L  T  E  D  K  K  K  W  N  L  G  S  N  A  K  D         p.80

          .         .         .         .         .         .       g.6647
 CCTCGAGGGATGTATCAGTGTAAAGGATCACAGAACAAGTCAAAACCACTCCAAGTGTAT       c.300
 P  R  G  M  Y  Q  C  K  G  S  Q  N  K  S  K  P  L  Q  V  Y         p.100

         | 04.         .         .         .         .         .    g.7288
 TACAGAA | TGTGTCAGAACTGCATTGAACTAAATGCAGCCACCATATCTGGCTTTCTCTTT    c.360
 Y  R  M |   C  Q  N  C  I  E  L  N  A  A  T  I  S  G  F  L  F      p.120

          .         .         .         .         .         .       g.7348
 GCTGAAATCGTCAGCATTTTCGTCCTTGCTGTTGGGGTCTACTTCATTGCTGGACAGGAT       c.420
 A  E  I  V  S  I  F  V  L  A  V  G  V  Y  F  I  A  G  Q  D         p.140

          .          | 05        .         .         .         .    g.8352
 GGAGTTCGCCAGTCGAGAG | CTTCAGACAAGCAGACTCTGTTGCCCAATGACCAGCTCTAC    c.480
 G  V  R  Q  S  R  A |   S  D  K  Q  T  L  L  P  N  D  Q  L  Y      p.160

     | 06    .         .         .         .         .         .    g.9144
 CAG | CCCCTCAAGGATCGAGAAGATGACCAGTACAGCCACCTTCAAGGAAACCAGTTGAGG    c.540
 Q   | P  L  K  D  R  E  D  D  Q  Y  S  H  L  Q  G  N  Q  L  R      p.180

                                                                g.9153
 AGGAATTGA |                                                       c.550
 R  N  X                                                         p.182

          .         | 07         .         .         .         .    g.9844
 actcaggactcagagtag | tccaggtgttctcctcctattcagttcccagaatcaaagcaa    c.*60

          .         .         .         .         .         .       g.9904
 tgcattttggaaagctcctagcagagagactttcagccctaaatctagactcaaggttcc       c.*120

          .         .         .         .         .         .       g.9964
 cagagatgacaaatggagaagaaaggccatcagagcaaatttgggggtttctcaaataaa       c.*180

          .         .         .         .         .         .       g.10024
 ataaaaataaaaacaaatactgtgtttcagaagcgccacctattggggaaaattgtaaaa       c.*240

          .         .         .         .         .         .       g.10084
 gaaaaatgaaaagatcaaataaccccctggatttgaatataattttttgtgttgtaattt       c.*300

          .         .         .         .         .         .       g.10144
 ttatttcgtttttgtataggttataattcacatggctcaaatattcagtgaaagctctcc       c.*360

          .         .         .         .         .         .       g.10204
 ctccaccgccatcccctgctacccagtgaccctgttgccctcttcagagacaaattagtt       c.*420

          .         .         .         .         .         .       g.10264
 tctcttttttttttttttttttttttttttgagacagtctggctctgtcacccaggctga       c.*480

          .         .         .         .         .         .       g.10324
 aatgcagtggcaccatctcggctcactgcaacctctgcctcctgggttcaagcgattctc       c.*540

          .         .         .         .         .         .       g.10384
 ctgcctcagcctcccgggcagctgggattacaggcacacactaccacacctggctaattt       c.*600

          .         .         .         .         .         .       g.10444
 ttgtatttttagtagagacagggttttgctctgttggccaagctggtctcgaactcctga       c.*660

          .         .                                               g.10466
 cctcaagtgatccgcccgcctc                                             c.*682

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The CD3g molecule, gamma (CD3-TCR complex) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center