CD79b molecule, immunoglobulin-associated beta (CD79B) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)


This file was created to facilitate the description of sequence variants in the CD79B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering CD79B transcript NM_000626.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .   | 02     .         .    g.354
 CTCGTAGGTGTGATCTTCCTCCATGCCAGCCTTGCTGTCATC | CTTGTCCAGCAGCAGGAA    c.60
 L  V  G  V  I  F  L  H  A  S  L  A  V  I   | L  V  Q  Q  Q  E      p.20

          .         .         .         .         .         .       g.414
 GATAGGCACGATGATGAAGAGGATGATCAGCAGCGTCTGGATCATGATGATACCATCCTT       c.120
 D  R  H  D  D  E  E  D  D  Q  Q  R  L  D  H  D  D  T  I  L         p.40

          .         .         .         .  | 03      .         .    g.659
 CAGCGTGTTCCTCTGCTTCAGCTGTGCCAAGGTGCTGAATC | CCATGACTCGCAGCTCTGT    c.180
 Q  R  V  P  L  L  Q  L  C  Q  G  A  E  S  |  H  D  S  Q  L  C      p.60

          .         .         .         .         .         .       g.719
 GCCGCAGCCCTGGTAGACCTCCGAGGTGTTGTTGCACTTCTGCTGACAGAAGTAGATGCC       c.240
 A  A  A  L  V  D  L  R  G  V  V  A  L  L  L  T  E  V  D  A         p.80

          .         .         .         .         .         .       g.779
 ATTGTCCTCAAACCGGATGCCTTGGATGGTGAGGGTGGCGAGAGATTCGTTCTGGGACTC       c.300
 I  V  L  K  P  D  A  L  D  G  E  G  G  E  R  F  V  L  G  L         p.100

          .         .         .         .         .         .       g.839
 TTCCATGCGGCCCTTTTCCAGCTTCAGCTGCTGGGGATTCTCGTCCATCTCCTGCTTCCA       c.360
 F  H  A  A  L  F  Q  L  Q  L  L  G  I  L  V  H  L  L  L  P         p.120

          .         .         .         .         .         .       g.899
 GAGCCAGCTCACATTGCCGGAGGCGCTGTTCATGTAGCAGTGCATTTTCACCGTGAAGCC       c.420
 E  P  A  H  I  A  G  G  A  V  H  V  A  V  H  F  H  R  E  A         p.140

          .         .         .         .         .    | 04    .    g.1908
 CCGTTTCCTGGCTATGAAACGTGGGCTCTGCCAGATCCGCGAACAAGCACTAC | CTTTGGG    c.480
 P  F  P  G  Y  E  T  W  A  L  P  D  P  R  T  S  T  T  |  F  G      p.160

          .         .         .         .     | 05                  g.2777
 ATTCCGGTACCGGTCCTCCGATCTGGCTGCTGGTACTGGCTCAG | CTGA                c.528
 I  P  V  P  V  L  R  S  G  C  W  Y  W  L  S  |  X                  p.175

          .         .         .         .         .         .       g.2837
 gagcagcagcagcaacgccaccatccagtggctgggcacaggagacaacgccagcctggc       c.*60

          .         .         .         .         .         .       g.2897
 catggtcaccgctctgtccccgaccccaaacccgtgacaacgtccgaggctccttggagg       c.*120

          .         .       | 06 .         .         .         .                                     g.2957
 aaaacgtgtaactgcaccggctgcag | t                                     c.*147

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The CD79b molecule, immunoglobulin-associated beta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center