CD8a molecule (CD8A) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the CD8A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering CD8A transcript NM_001768.6.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .  | 02      .                        g.822
 CGGGGACATTTGCAAACACGTCTTCGGTTCC | TGTGGTTGCAGTAA                   c.45
 R  G  H  L  Q  T  R  L  R  F  L |   W  L  Q  X                     p.14

          .         .         .         .         .         .       g.882
 agggtgataaccagtgacaggagaaggaccccacaagtcccggccaagggcgcccagatg       c.*60

          .         .         .        | 03.         .         .    g.1148
 tagatatcacaggcgaagtccagccccctcgtgtgca | ctgcgccccccgccgctggccgg    c.*120

          .         .         .         .         .         .       g.1208
 cacgcctctgggcgcagggacaggggctgcgacgcgatggtgggcgccggtgttggtggt       c.*180

          .         .         | 04         .         .         .    g.1845
 cgcggcgctggcgtcgtggtgggcttcg | ctggcaggaagaccggcacgaagtggctgaag    c.*240

          .         .         .         .         .         .       g.1905
 tacatgatggagttgctcagggccgagcagaaatagtagccctcgttctctcggcggaag       c.*300

          .         .         .         .         .         .       g.1965
 tcgctcagggtgaggacgaaggtgtcccccaacctcttgcccgagaaccgctgggtgtcc       c.*360

          .         .         .         .         .         .       g.2025
 agcccctcggccgccttgggcttgttttgggagaggtataggaggaaggtgggactggcg       c.*420

          .         .         .         .         .         .       g.2085
 gcggcgccgcgcggctggaagagccacgagcagcccgacgtcgggttggacagcagcacc       c.*480

          .         .         .         .         .         .       g.2145
 tggcacttcagctccactgtctcgcccaggttccaggtccgatccagcggcgacacccgg       c.*540

          .         .   | 05     .         .         .         .    g.2300
 aactggctcggcctggcggcgt | ggagcagcaaggccagcggcaggagcaaggcggtcact    c.*600

          .         .         .         .         .         .       g.2360
 ggtaaggccatgacgcgctccccaggacgctgcttggctcgaagctcgggcgcgagggga       c.*660

          .         .         .         .         .         .       g.2420
 ggcgcgcgggagccggtggggcgccgaggggggaaagttgcgcccttcggccggcccgga       c.*720

          .         .         .         .         .         .       g.2480
 gcctgatttcgcatttggaggatgtgatgtcacccgaagcccccgccgaggagagtcacc       c.*780

          .         .         .         .         .         .       g.2540
 ctccttttcgcggttgtcgccttccagcccggcgaggaggctggggcccgtgaatagggc       c.*840

          .         .         .         .         .         .       g.2600
 cgtcgaggcagcctggccaggcaactgggggcagctgaaaactgcgggtttggggatgag       c.*900

          .         .         .         .         .         .       g.2660
 gaaaagggcttggaaatagtccttggaaatggttgtcttgtgagagtgacagagtgggtg       c.*960

          .         .         .         .         .         .       g.2720
 aagggagaccaaagatttcaagaagtgagggcgagagtaggcagcaaaggaggggagtgt       c.*1020

          .         .         .         .         .         .       g.2780
 cccttcctttgccttcactaaaggcgtctcttgtactgtcaccttgggactttttattgg       c.*1080

          .         .         .         .         .         .       g.2840
 caaaatgggcactgagggctgaaaaggaagaggaactagcgacctgcccgcttctgagga       c.*1140

          .         .         .         .         .         .       g.2900
 actcgctagagcagccccagttttcaccgaggaaggaccctctcccttcccccaggagat       c.*1200

          .         .         .         .         .         .       g.2960
 ttccatgagagcggcagcagccgaagctttgggtgtcggtgtcagtgcgctgctgacctc       c.*1260

          .         .         .         .         .         .       g.3020
 attcttccggcctttcatccagcggctaaactcaccacacagcctcatctcttcttggag       c.*1320

          .         .         .         .         .         .       g.3080
 ccattgcaacagccttcaattcacaccagtctctctcctgatcagtcctccagccacgtt       c.*1380

          .         .         .         .         .         .       g.3140
 gttataaaaattattattctcacaaaggggatctgacagcgtcactgctgcagcctccca       c.*1440

          .         .         .         .         .         .       g.3200
 tggcctgcattgctggatggaaattcaacccccagcttggttgaccagcccttgggtgct       c.*1500

  | 06       .         .         .         .         .         .                                                               g.12779
  | t                                                               c.*1501

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The CD8a molecule protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.