CCAAT/enhancer binding protein (C/EBP), epsilon (CEBPE) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the CEBPE gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000014.8, covering CEBPE transcript NM_001805.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTGAGAACGCGCAGAGGCTGGCCGGGTGCTGCCAGAGTTGGGGGCAGGTGCATGGCTGT       c.60
 L  E  N  A  Q  R  L  A  G  C  C  Q  S  W  G  Q  V  H  G  C         p.20

          .         .         .         .         .         .       g.120
 CTGCCCACAGTGTGCCACTTGGTACTGCAGGGGATTGTAGCTGCCTCGGCTGGCAGCTCG       c.120
 L  P  T  V  C  H  L  V  L  Q  G  I  V  A  A  S  A  G  S  S         p.40

          .         .         .         .         .         .       g.180
 GCTGCCCTCTGGCCCCCGGGGCTCCTCCTTCACCGCCACAGCCCTGGGGTCGTAGCTCCC       c.180
 A  A  L  W  P  P  G  L  L  L  H  R  H  S  P  G  V  V  A  P         p.60

          .         .         .         .         .         .       g.240
 TGGGCTGCTGTAGATGCCAGGCCCCAGCGCCTTCCTGTCTGGGCCGAAGGTATGTGGAGG       c.240
 W  A  A  V  D  A  R  P  Q  R  L  P  V  W  A  E  G  M  W  R         p.80

          .         .         .         .         .         .       g.300
 GTAGGCAAAGGGCCGAGGGTCAGGCGGCAAGTAGTGGGGGAAGGCAGGGGTTCCGGGGCC       c.300
 V  G  K  G  P  R  V  R  R  Q  V  V  G  E  G  R  G  S  G  A         p.100

          .         .         .         .         .         .       g.360
 CTTGAGGCCTCTGGCCTCAGGCGCTGGCTTCACGGCAAAGAGATCGGAGAGAAGCTGCTC       c.360
 L  E  A  S  G  L  R  R  W  L  H  G  K  E  I  G  E  K  L  L         p.120

          .         .         .         .         .         .       g.420
 TTCCCCAGACTCGATGTAGGCGGAGAGGTCAATGGAGGCCTCATGCTCACACATGTCCCC       c.420
 F  P  R  L  D  V  G  G  E  V  N  G  G  L  M  L  T  H  V  P         p.140

                                                                    g.423
 TAG                                                                c.423
 X                                                                  p.140

          .         .         .         .         .         .       g.483
 ctccccgggcccagctcggccccctgagaactcgagtggctgctggccaccccggggctc       c.*60

          .         .         .         .         .         .       g.543
 acactcgtagtaggtcccgtgggacatggccggcccgccccctcggctccccgcccccac       c.*120

          .         .         .         .         .         .       g.603
 ctgctcttgaggcaccccttggggtgctccggctgccctctctctacctcctcctgacct       c.*180

          .         .         .         .         .         .       g.663
 gggcctgccctctctcgatcttctgccctagacctgccctctgcagtctcctctgtcacc       c.*240

          .         .         .         .         .         .       g.723
 cactcctgtgtggcctctctcccccctctgctctgcttccttttccttcctctgtagtca       c.*300

          .         .         .         .         .         .       g.783
 atgcctctcttctcttcccttttttcccctctctccccttggggtgactcagggaggggc       c.*360

          .         .         .         .         .         .       g.843
 aggacacaccccagagggagagatgtaagccttagagaaaggcgactcctggcctattca       c.*420

          .         .         .         .         .         .       g.903
 gcagttggggacactccttggtcagggaccaagccagggttctggagatgcccgaagctg       c.*480

          .         .         .         .         .         .       g.963
 atgcttctgggaatgcctctccactccctgctgggaggccaggggactccaaatcctcgc       c.*540

          .         .         .         .         .         .       g.1023
 agagggcaacaccccactctgagcaacctcctccctccgactttgaaaaagttctatgca       c.*600

         | 02.         .         .         .         .         .                                                        g.1083
 gaatgag | a                                                        c.*608

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The CCAAT/enhancer binding protein (C/EBP), epsilon protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.