complement factor I (CFI) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the CFI gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering CFI transcript NM_000204.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .                           g.48
 CTGCACATTCCATTTCTTTTTCATAGAAACGATTTCCGTAAAACTTAG                   c.48
 L  H  I  P  F  L  F  H  R  N  D  F  R  K  T  X                     p.15

          .         .         .         .         .        | 02.    g.3734
 agcagttgcttattagtttaacttcaccccactgaagtgaaaagactctttcgttat | ctt    c.*60

          .         .         .         .         .         .       g.3794
 tttctcgtccccagccagaaacgatgcatgtatcattaggttggaataggtaaggagacc       c.*120

          .         .         .         .         .         .       g.3854
 aggggacacaggcagggatggaacgaggcagctcacaatcttttttgtttccgtcttttt       c.*180

          .         .         .         .         .         .       g.3914
 tcatttcaatcaaagcgatgtcattttggtaagtgcctgcattgtagttttcatggaaaa       c.*240

          .         .         .         .         .         .       g.3974
 taattctatccacgtattcaattactatacgtttaaggtcggggtgtatccagtctacta       c.*300

          .         .         .         | 03         .         .    g.6749
 ctgttgtccatatttggtaacgatgagttttactggct | ctgagacaatgtgcagcagtca    c.*360

          .         .         .         .         .         .       g.6809
 gaatccaacagccaccaatataaattcccccacaggtgattccactggcatccttaattg       c.*420

          .         .   | 04     .         .         .         .    g.7046
 ccacctgccatgggaggtctcc | cagttgtgctcgctttcctcccacaattcgtttccttc    c.*480

          .         .         .         .         .         .       g.7106
 gaatgtgcattctgtttttaactccacaagatagtttaggtaataatgattttatccgtc       c.*540

        | 05 .         .         .         .   | 06     .         . g.15290
 ttcttt | ctgcatccatgtcagcagtcaaaatttctgtttctt | cttgagtcacagatgcaa c.*600

     | 07    .         .         .         .         .         .    g.17836
 agc | ctgcacagccaacttcatcttcccctgtaatgcagtccacctcaccattgcattgat    c.*660

          .         .         .         .         .     | 08   .    g.18038
 actggcttggaatgcaaacacccgatttgcaatggaagcctttgccttggcatg | ctttac    c.*720

          .         .         .         .         .         .       g.18098
 aacacagttcatcactttggtctccacaatcattgataccatcacaggctttcatctgag       c.*780

          .         .         .         .         | 09         .    g.19038
 aaatgtatttcccattcacacactgaaagaagtcatccattggagaat | ctgctttctgtg    c.*840

          .         .         .         .         .         .       g.19098
 tataacaaaccacatcagcgaaatcctggtaacccatagttcttctcttagtaaaagtac       c.*900

          .         .         .         .         .         .       g.19158
 attcagccaaactggtctctaatcctcggcaatgcacatgtagacattcagtggaattta       c.*960

          .         .         .         .     | 10   .         .    g.22062
 tagagagatcagacaacttaaaccttctttgagtatcagcacct | tgttgaaacccaaggt    c.*1020

          .         .         .         .         .         .       g.22122
 caaggcaggccacgttggcttccctcatgctccagctgcttttgcatatgaacattgtct       c.*1080

          .         .         .         .         .         .       g.22182
 tatcttggtccacaagttttacttcaactattccctctgaatctgtatttccatgcttca       c.*1140

          .         | 11         .         .         .         .    g.24105
 aggaaacactaaactttc | cttcggctgtgcatgttccgttatttaaaaactttgtccctg    c.*1200

          .         .         .         .         .         .       g.24165
 gatgaagacattccaaactcttttgttgacagtatgttgggaagcttctcctgttagttg       c.*1260

          .         .         .         .         .         .       g.24225
 cacacactgcagtgccattctttgggcactgatacggtagtttacaaacacaggtgccct       c.*1320

          .         .         .         .         .         .       g.24285
 caatgcatctctgccatggctggcagaagactttatcgcaggagaggtgagtatattttt       c.*1380

          .         .         .         .          | 12        .    g.59435
 ttgctaagcactttttctccaccagatcctcttgagatgtataagtgac | cttgcaaaacc    c.*1440

          .         .         .         .         .         .       g.59495
 ttaagtggaagcacagaaataacaggaaaacatgaagaagcttcatgttggaggtgttcg       c.*1500

          .         .         .         .         .         .       g.59555
 gggtctttgtctctgctgagaactcttttccactccaggtattcttttgaaatttaattt       c.*1560

          .         .         .         .         .         .       g.59615
 ttaacctctgaaaaaatgtttcaaaagaacaaacctcctaaagagctttgtacttttgaa       c.*1620

          .         .         .         .         .         .       g.59675
 ctctgaaagaatttggctgaaatccagagagatttaccgtaactgaaaccaaaaaatggc       c.*1680

          .     | 13   .         .         .         .         .                                                 g.59735
 cttcccattaaaga | c                                                 c.*1695

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Complement factor I protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.