complement factor properdin (CFP) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the CFP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering CFP transcript NM_002621.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 GGGTACTTGGGGAGCAAGGGTGTGCAGAGGCGCTGGCGGGCACGGGTAGGATTAGGTCCA       c.60
 G  Y  L  G  S  K  G  V  Q  R  R  W  R  A  R  V  G  L  G  P         p.20

          .         .         .         .         .   | 02     .    g.278
 CAGGGGGGCATGCACAGCCCCCAGGTACTCCACTCTGACCATGATCCTTTCA | AGGGGCAG    c.120
 Q  G  G  M  H  S  P  Q  V  L  H  S  D  H  D  P  F  K |   G  Q      p.40

          .                                                         g.293
 TGCTGGATGCTGTAG                                                    c.135
 C  W  M  L  X                                                      p.44

          .         .         .         .         .         .       g.353
 cagtgccggatatcctgctgttgcccggcacatcgatgtccgtcaaacttgcggcccctg       c.*60

          .         .         .         .         .         .       g.413
 caggtcctcccgcgtgactgctggcccgggatttcttgacagctgatggacttcatgttc       c.*120

          .         .         .         .          | 03        .    g.726
 cgtcggatacaggggctccactccccccacgagtcccactccccatcca | cagggcagggc    c.*180

          .         .         .         .         .         .       g.786
 acagctgtgttgcagatgtgggtccgggtggcatcgccagcacagaaggggcccccatgc       c.*240

          .         .         .         .         .         .       g.846
 tggggcacagggtgattgcacgtccgttgttccatggtctggcccaggccacaggtcaca       c.*300

          .         .         .         .    | 04    .         .    g.1100
 gggcaggggctcacagggccccaaggcccccagcccccagcca | ctgggcagggtggcagg    c.*360

          .         .         .         .         .         .       g.1160
 ccggtgcacctccgctgctcgtaggctagccccgggcagggcttcccaggaggtttctgg       c.*420

          .         .         .         .         .         .       g.1220
 gagggctcaggtgcagaacacttgcggcttcgtgtctccttaggttcgtggggtccaccg       c.*480

          .         .         .         .         .      | 05  .    g.1418
 tggcaggaggctgagcagggggtccaggggccccaggtggcccaggccccgtgtg | tgggg    c.*540

          .         .         .         .         .         .       g.1478
 cagacctgctgggtgtcacaggcctctgattcctgtgcctgtcctgggcagtggccccca       c.*600

          .         .         .         .         .         .       g.1538
 cacttgggagcagggtgattacaggctcgcctgcgggtccgggtccctttggagcaggtg       c.*660

          .         .         .         .       | 06 .         .    g.2058
 acagagcaaggctcccagggcccccagccagaccagccgcccatct | caggacagcactgc    c.*720

          .         .         .         .         .         .       g.2118
 tggtcctcacaggcctggagctgccactccagggtcccaggtgccacctttccagagcac       c.*780

          .         .         .         .         .         .       g.2178
 tgcccattccagcccacacagcgccggtaccgcagctgggagccctcagagcacgtcacc       c.*840

          .         .         .         .   | 07     .         .    g.3484
 gaacagggggcccatgtggaccacagggaccatcgtggggac | ctgcaaggctgacagagc    c.*900

          .         .         .         .         .         .       g.3544
 ccaccactacgtttctggtaggcaaaggcagtgttgagacagcagtcttccacgctgaca       c.*960

          .         .         .         .         .         .       g.3604
 ccaccccccaggaggcccttgcacttgccggaggattcttcatactgggtgaagcagagc       c.*1020

          .    | 08    .         .         .         .         .    g.3758
 acggggtctgagc | ctgtggctggcagggtgagcagcaggagcagcggcggcagcaacaat    c.*1080

          .         .         .         .         .         .       g.3818
 cgaggggcctgcgctccctctgtgatcatgttgagtactgccccctgcacctctaccaga       c.*1140

          .         .         .     | 09   .         .         .    g.4097
 gaggaggtcccgctttatctgggttgataggctc | ccagaggaaatggagcataggagcgt    c.*1200

          .         .         .         .         .         .       g.4157
 gcagcaacttcctagccgtgtgaccttgggtgagtcacttaacacccctgagcctcagtt       c.*1260

          .         .         .         .         .         .       g.4217
 tccctatgtggaaaatgcataatctctaacataatgacggggtcaacctcgtgggggtgt       c.*1320

          .         .         .  | 10      .         .         .                                g.4277
 tgaaccagggtgaagtgagtgtgcggtgctc | c                                c.*1352

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Complement factor properdin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.