C-type lectin domain family 7, member A (CLEC7A) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the CLEC7A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering CLEC7A transcript NM_197947.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 AAGTTAGAAGAGAATGTTGATCCATCCTCCCAGAGCCATGGTACCTCAGTCTGGGGCCGA       c.60
 K  L  E  E  N  V  D  P  S  S  Q  S  H  G  T  S  V  W  G  R         p.20

          .         .         .         .         .          | 02    g.2053
 GAAAGGCCTATCCAAAATGAATTATCAGGTTGGGAAGACACTTGTTTTACTATAAATCC | C    c.120
 E  R  P  I  Q  N  E  L  S  G  W  E  D  T  C  F  T  I  N  P  |      p.40

          .         .         .         .         .         .       g.2113
 AATTCATTTGAGCTGTCTATCTTTAGGAGATTAGAGCCCAGTTGCCAGCATTGTCTTTTA       c.180
 N  S  F  E  L  S  I  F  R  R  L  E  P  S  C  Q  H  C  L  L         p.60

          .         .         .                                     g.2152
 CTTCCATCCCAGGAATTTAGTGACATGCTGAATAGATAA                            c.219
 L  P  S  Q  E  F  S  D  M  L  N  R  X                              p.72

          .         .         .         .         .   | 03     .    g.3334
 cagctcttctcatatataatccaattaggaggacaagggctggaaagaaccc | ctgtggtt    c.*60

          .         .         .         .         .         .       g.3394
 ttgacagctttggtaggagtcacactgtcttctaaagatgattgtgtgggttgactgtgg       c.*120

          .         .         .         .         .         .       g.3454
 ttctctttatttcttgatagaaagtagccattctccaatgtgttgcttcctgaattggat       c.*180

          . | 04       .         .         .         .         .    g.4552
 ctccaaatag | ccatggtacccaggaccacagctatcaccagtattaccaagcataggatt    c.*240

          .         .         .         .          | 05        .    g.6746
 cccaaaattacagcaatgaggcgccaaggaggagatgcagcacacgatc | ctttctctgaa    c.*300

          .         .         .         .         .         .       g.6806
 acaacagctatcctggtattgctttgagagtcgaagtgtaattgagtatatccatcttca       c.*360

          .         .         .         .         .         .       g.6866
 tccaaattttctaaatcaggatgatattccattgttcttgagagcccctgaatagatata       c.*420

          .         .         .         .         .         .       g.6926
 gcatttgggagctcttttctttctgctcctgagatgactgtctgtggacaaaagagaatc       c.*480

          .         .         .         .         .         .       g.6986
 tctgagtcaaatcatgtgggctaggtacttaccggagtttaacaaattaagcttaagtag       c.*540

          .         .         .          | 06        .         .                        g.7046
 ttcaaccagatattcaagagcaggaaatgaaactatgct | a                        c.*580

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The C-type lectin domain family 7, member A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.