colony stimulating factor 3 receptor (granulocyte) (CSF3R) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the CSF3R gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering CSF3R transcript NM_000760.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTCCTCCATGATTGTGGGCACCCAGGAGCCCAGGCTGCTGTGAGCTGGGTCTGGGACACT       c.60
 L  L  H  D  C  G  H  P  G  A  Q  A  A  V  S  W  V  W  D  T         p.20

          .         .   | 02     .         .         .         .    g.366
 TGGCCAGAGGGGATTCTTCCTG | TTGGGGCTGCAACAGAGCCAGGCAGTTCCACAGAGGCA    c.120
 W  P  E  G  I  L  P  V |   G  A  A  T  E  P  G  S  S  T  E  A      p.40

          .         .         .         .                       g.411
 GGTGAGCAACAGCAGGAGGCCGAACAGGCCCAGGATGATGTGTAG |                   c.166
 G  E  Q  Q  Q  E  A  E  Q  A  Q  D  D  V  X                     p.54

          .  | 03      .         .         .         .         .    g.641
 ctccgacccct | ctggggtcaaggtcatcagggtgaggactgtactgttggtggccccagc    c.*60

          .         .         .         .         .         .       g.701
 ctggctggcagccatgaggtggatgtgatacagactggcgggctccaggccatggaggac       c.*120

          .         .         .   | 04     .         .         .    g.873
 aaagccacgggaggaggcattcaggatggcgg | agaaggactggttctgagcgttggtcca    c.*180

          .         .         .         .         .         .       g.933
 gaagatggtgtagtgggtaagggggctcttccccagctcagggggctcaggcacccactc       c.*240

          .         .         .         .         .          | 05    g.1927
 cagctgtgcccaggtcttgccaatgtgctttagatgcagctctggggcatgggagggag | c    c.*300

          .         .         .         .         .         .       g.1987
 catttcttgagagtaggcatagacatgctgggagggtcccatggtgtcctggtacaaggg       c.*360

          .         .         .         .  | 06      .         .    g.2441
 agtcacgatgatctcatagagctgaaagggcctgatgttct | ccttcagcagaaaccccgt    c.*420

          .         .         .         .         .         .       g.2501
 ggctctcccattctgttccatcctccaggtcttgttgctattgctcgcgctgggggggcc       c.*480

          .         .         .         .         .         .       g.2561
 caggccccactcaatcacatagccctgaggccatggattggggggctcccagcctaccca       c.*540

          .         .         .         .         . | 07       .    g.4213
 gaggctgtgagggtctcgggccatggcatggagtctggtcagagctgggc | ctctgctttc    c.*600

          .         .         .         .         .         .       g.4273
 tgagaagaccaccggagtgggacgagaggtcccggctgagttataggccacaagggccac       c.*660

          .         .         .         .         .         .       g.4333
 ctcctgggcttctgaaggcaggtggaaggtgcagctgagctctgtggtgttgcagagggg       c.*720

          .         .         .         .         .         .       g.4393
 caggatggccccagcctggcctgagggtctccaagaaaccacataaccttggatccgtcc       c.*780

          .         .     | 08   .         .         .         .    g.4872
 gctgtcttcctccaggggcactgg | cttccagaacagctgcactgtcctggggtccagctg    c.*840

          .         .         .         | 09         .         .    g.5030
 cctctgccgccaccatgtgtccagtctgacagtggggg | cccgttcggtagttctcagctc    c.*900

          .         .         .         .         .         .       g.5090
 caggctggggctccagtcgctccagtggccaggcaggggccagcggatgcagcgtatctg       c.*960

          .         .         .         .         .         .       g.5150
 cagggtgtaggccgtggctgggaggagcccgcagagctcatactgaagggcctccaaggg       c.*1020

          .   | 10     .         .         .         .         .    g.5335
 gagggggcccac | cagtgcccagctggcttctccacgctgcggcttgtggcgcagctcaca    c.*1080

          .         .         .         .         .         .       g.5395
 cttctgatttatgtgcaggcctggctgccatggctcccagcacagctgtaggcagcctgc       c.*1140

          .         .         .         .         .         .       g.5455
 ctggggaggggccgcttcagggctggggtccatggtccgcagcatggggggctccagttt       c.*1200

    | 11     .         .         .         .         .         .    g.6263
 ca | caacatccatgggatcaagacacagttgtggggacatgctggtccccagcgcattctc    c.*1260

          .         .         .         .         .         .       g.6323
 tgcctgcacccagatgcccatattctggtacaacagcaggtgtttgcgtgggatgcagca       c.*1320

          .         .         .         .         .         .       g.6383
 gtggctctgcccgtccttgggcacgcagtccaggatggagtccccttgggtctgacagtt       c.*1380

          . | 12       .         .         .         .         .    g.6584
 gccccggctc | ttgaaactcttcagagtgaagctggtgggtaggtgggtctcaggtcctgg    c.*1440

          .         .         .         .         .         .       g.6644
 ctcccactggcagatgaggctgctggttgtgaggttcatgaggcaggagaggttgtgggg       c.*1500

          .     | 13   .         .         .         .         .    g.8193
 tatggctggagggt | agcctgcgcgcagctcaacctggtccaggatctgcaggctgttgcc    c.*1560

          .         .         .         .         .         .       g.8253
 ccagttcaggcagcaggagagaaaggcctgagtgtggttgaggtggggcagggtgatgat       c.*1620

          .         .         .         .         .         .       g.8313
 agattcctgggtcccatcagacagacgctgctgcctgcccccgggctgaagctctgctcc       c.*1680

          .         .         .         .         .         .       g.8373
 cagtctccacagaatctgtggctccgggtccagatggctgcagttctgcttgatgatgca       c.*1740

          .         .         .         .         .         .       g.8433
 ggaggctgtgatgggatcccccaggtggacgatgggggctgagacactgatgtgcccgca       c.*1800

          .  | 14      .         .         .         .         .    g.12252
 ctcctccagac | ttccggggagcagcaggatgatcagggcagcccaagtcaggctgcagtt    c.*1860

          .         .         .      | 15  .         .         .    g.14273
 tcccagccttgccatagcaccaacttgatgttcac | cagctttgtgatcttggacaagtta    c.*1920

          .         .         .      | 16  .         .         .    g.15606
 cttcacctttccgagccgagcctcagtttccccat | gttggcacctctggcccagcccctg    c.*1980

          .         .         .         .         .         .       g.15666
 cttggcctccttggtctctcttctcgtcaagagaagttcctgaaaccagctgcagtccag       c.*2040

          .         .         .         .         .         .       g.15726
 cttctctccccgagctctgtcgttaatggctcagcctctgacaggcccgggggctgggga       c.*2100

          .         .         .         .         .         .       g.15786
 ttgcaacaccttccgagcctccctcctgccctcccttgcgccttcgagggcacaggcagc       c.*2160

          .         .         .         .         .         .       g.15846
 cccttcctcccaggaaggagcctgtgagggaagctggtgaggcccgggcagccttcctgc       c.*2220

          .         .         .         .         .         .       g.15906
 cttgggggtcttaaagggctggggaatgtggcaacgatgtccccctcccctgcctccgga       c.*2280

          .         .         .         .         .         .       g.15966
 tttcctgagctcaaagctttgaggctgggcagggcccaggctcccacctggctgggtgcc       c.*2340

          .         .         .         .         .         .       g.16026
 atccttatgccccctgccctgggggagcatcacttggaggcaggccctggctggaaggct       c.*2400

          .         .         .         .         .          | 17    g.16086
 cacccggccctaagcctcttttcagctctagccttggggaccacatcttcacagtactc | a    c.*2460

 

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Colony stimulating factor 3 receptor (granulocyte) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.