chemokine (C-X-C motif) receptor 4 (CXCR4) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the CXCR4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering CXCR4 transcript NM_003467.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 ACTGATCCCCTCCATGGTAACCGCTGGTTCTCCAGATGCGGTGGCTACTGGAGCACTCAG       c.60
 T  D  P  L  H  G  N  R  W  F  S  R  C  G  G  Y  W  S  T  Q         p.20

          .         .         .         .         . | 02       .             g.120
 GCCCTCGGCGTCACTTTGCTACCTGCTGCCGCAGCCAACAAACTGAAGTT | C             c.111
 A  L  G  V  T  L  L  P  A  A  A  A  N  K  L  K  F  |  ?  ?  ?      p.37

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Chemokine (C-X-C motif) receptor 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.