cytochrome b-245, alpha polypeptide (CYBA) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the CYBA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering CYBA transcript NM_000101.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.6
 CAGTAG                                                             c.6
 Q  X                                                               p.1

          .         .         .         .         .         .       g.66
 gtagatgccgctcgcaatggccaggcaggcggtcccaaggatggtggccagcaggaagcc       c.*60

          .       | 02 .         .         .         .         .    g.683
 ggcgggcaccgagagc | aggagatgcaggacggcccgaacatagtaattcctggtaaaggg    c.*120

          .         .         .         . | 03       .         .    g.1005
 cccgaacagcttcaccacggcggtcatgtacttctgtccc | cagcgctccatggtggagcc    c.*180

          .         .         .         .         .      | 04  .    g.1934
 cttcttcctcttcccccgggggtactccagcaggcacacaaacacgcccgccaca | atgga    c.*240

          .         .         .         .         .         .       g.1994
 gtaggcaccaaagtaccactgggtgaagcgcccagctgtggccacgatgcccccggtgat       c.*300

       | 05  .         .         .         .         .         .    g.4895
 gagga | tcaggccggacgccagcgcctgttcgttggcccacatggcccactcgatctgccc    c.*360

          .         .         .         .         .         .       g.4955
 catggcgacacgaacccggctgggacactgctaggcgcgcactgccgcccctgcgctccc       c.*420

          .     | 06   .         .         .         .         .                                                 g.5015
 ggccgaaccccgcc | a                                                 c.*435

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cytochrome b-245, alpha polypeptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.