DNA cross-link repair 1C (DCLRE1C) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the DCLRE1C gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering DCLRE1C transcript NM_001033855.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .                                               g.24
 CTGAGTCTCGGTGAACTGTTCTAG                                           c.24
 L  S  L  G  E  L  F  X                                             p.7

          .         .         .         .         .         .       g.84
 ctctcttcagttttcccagtggtttatactttggctccgtactttgggaagaccggcata       c.*60

          .  | 02      .         .         .         .         .    g.3292
 aaggctttaag | atttcgacaactttatccatagttgtgccaactggaatgacatttggat    c.*120

          .         .         .         . | 03       .         .    g.7125
 atgcgttcacaggacagaggtagctcaagaaatctttaat | ctcactgtaggaggagtgaa    c.*180

          .         .         .      | 04  .         .         .    g.8303
 aagaaaaacaagctctgtatgaactctctccagtc | ctcacaattacatttgtttttctgc    c.*240

          .         .         .         .         .         .       g.8363
 tcctttctccaaaccacatggtggatggcttaatgctgattatgtggagtggaattctat       c.*300

          .         .         .         .         .   | 05     .    g.13124
 ttctggaagtaattccacagggtaatttgctccactgaaaatattcctctgc | cttgggat    c.*360

          .         .         .         .         .         .       g.13184
 gccggcatgcatggatctgagtgttgcggtctgttgtgagatgatgaaggatctcaggca       c.*420

          .         .         .     | 06   .         .         .    g.14668
 tgttcctaaacatgtctagcttattcacatgaac | ctggactcctaattcttcactaaggt    c.*480

          .         .         .         .         .         .       g.14728
 tggtgaacagatattcatagccataagccgctttgcagttcagccacacaacatggtacg       c.*540

          .         .         .         .         .      | 07  .    g.14970
 ggctccgagtgatccagcttcggaccagctctaagactccacttaaacactcctc | ccgac    c.*600

          .         .         .         .         .         .       g.15030
 ttggaatttggtaaaatcttggatcacagaacgtagtatccaaatatacactttggatgt       c.*660

          | 08         .         .         .         .         .    g.15777
 ctttgact | ctgcccccggagtgcagaagctccattctagcagcttctccttgcgccaatc    c.*720

          .         .         .         .         . | 09       .    g.16810
 tgaagtctcctgtgtacaggacagttccattattgccctgaaataaaaac | ataactgatc    c.*780

          .         .         .         .       | 10 .         .    g.20086
 ccggacagtgaccagctggtaagagagtcacaacaatctcttcctt | ctctcctgatgctt    c.*840

          .         .         .         .       | 11 .         .    g.25381
 catccactaaagatatctgggtaggagtctcgatttcaatagatat | aattcgtttcttcc    c.*900

          .         .         .         .         .         .       g.25441
 aaaatctgtatttcgggctcgttaacaacaactccttagtcacaggtgaacagtatagat       c.*960

          .  | 12      .         .         .         .         .    g.29347
 aaaccttcaag | ctgcactccaaccttcttttcaaggtaggggctcttaatcctttcatgt    c.*1020

     | 13    .         .         .         .         .         .    g.34221
 gat | ctttgtggcagtgggacaggaagtaggcgcgggccctcaggttctccctatcgaagc    c.*1080

          .         .         .         .         .         .       g.34281
 ggtctatggagatagttggatactcggccatctgcccctcgaaagaactcatagcgccgc       c.*1140

          .         .         .         .         .         .       g.34341
 cgatcccagagtccgggaccccaaaaccgcagctgaagccaaggccagccctgaccgcgc       c.*1200

          .        | 14.         .         .         .         .                                              g.34401
 cgccacttccgggaagc | t                                              c.*1218

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The DNA cross-link repair 1C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.