dystrobrevin binding protein 1 (DTNBP1) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the DTNBP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering DTNBP1 transcript NM_032122.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTAAGGCGGGGGACAGCACAGTGTTCTCTTCTCCTCCAGAGTTCAGGAAGACGTCCAGGG       c.60
 L  R  R  G  T  A  Q  C  S  L  L  L  Q  S  S  G  R  R  P  G         p.20

          .         .         .         .         .         .       g.120
 CCTCCTGGTCCGATATGTCCATCAGGTCCATCTGCTCCAGCATGTCCACGTTCACTTCCA       c.120
 P  P  G  P  I  C  P  S  G  P  S  A  P  A  C  P  R  S  L  P         p.40

          .         .     | 02   .         .         .         .    g.8750
 TGGATGACATGCTGCCTATGGGCT | CTCGCCGCTCTGCAATCTGCAGGTAGCCAGTGGACA    c.180
 W  M  T  C  C  L  W  A   | L  A  A  L  Q  S  A  G  S  Q  W  T      p.60

          .         .         .         .         .         .       g.8810
 GGTACTGCTCCATGTCCTGCTGGAAGGCTTCCTCAAAAAACTTCTGCCGCTCCTTCAGCT       c.240
 G  T  A  P  C  P  A  G  R  L  P  Q  K  T  S  A  A  P  S  A         p.80

          .         .         .         .         .         .       g.8870
 TCATTTGCTGGGTGTGCTCCATTTCCAGGACCTTCTGGGCGTGCTCTGCATCTAGTTCAG       c.300
 S  F  A  G  C  A  P  F  P  G  P  S  G  R  A  L  H  L  V  Q         p.100

  | 03                                                          g.68593
  | CTTTGA |                                                       c.307
  | L  X                                                         p.101

          .        | 04.         .         .         .         .    g.90838
 aggtttcaagttccttc | ctcttatttttcttgtaattctccagttgctgggactgcatat    c.*60

          .         .         .         .         .         .       g.90898
 gtttgcatctttctaattcacactgcccacataagtcttccagatgcagcaggttgttct       c.*120

          .         .         . | 05       .         .         .    g.102901
 ctacctcctcaaaactcgcctctaaatgag | tcagatttgctgtcatggattctaagtctg    c.*180

          .         .         .         .         .         .       g.102961
 cgattaaagctgggagctgctggagctgctcttgcagctccacgaggcttgtctttttct       c.*240

          .         .         .         .    | 06    .         .    g.113289
 tctcccagtgcgcagaaagcatgaccacctcgctatccaccag | ctctccagcacttgcac    c.*300

          .         .         .         .     | 07   .         .    g.126857
 agtctttggctcttctgtgaagtgcagcccatgtatcctcatac | ctgctaagtaattcta    c.*360

          .         .         .      | 08  .         .         .    g.127640
 atccagcagagtactttggcaaaaatggaacagtc | ctgggtttgcttttcacttttgctt    c.*420

          .         .          | 09        .         .         .    g.138373
 ctcttgacttgtcacttaaagtcttcagc | ccggaggtgaaatcctgctgcacgctcagca    c.*480

          .         .         .         .         .         .       g.138433
 gccgctcgcgaagggtctccagcattgccgccgccgccggtctcctctcctcaggcctcg       c.*540

          .         .         .         .         .         .       g.138493
 ggctgctgctgcctctgtcgccccctgggtcccacgccgccaaccccgcgctgtcaccgc       c.*600

          .         .         .         .         .         .       g.138553
 gcgccccgcactcccactaccggccccgcccccggtctggtcctcgccgccgcgccgcaa       c.*660

          .         .         .     | 10   .         .         .                             g.138613
 ccccagccccttccgcgttcccgccccgcgcgcg | c                             c.*695

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Dystrobrevin binding protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.