Fas (TNFRSF6)-associated via death domain (FADD) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the FADD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering FADD transcript NM_003824.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.1057
    gacgatacgccgggcgcaggcgcagaagccgcgcccgtccgcggcgccgccagccag       c.-241

 .         .         .         .         .         .                g.1117
 ggcggaaacggctgcggcttcgctagggacgcatgcgcgggtcccttagttttcgcgaga       c.-181

 .         .         .         .         .         .                g.1177
 taacggtcgaaaacgcgctcttgtcgatttcctgtagtgaatcaggcaccggagtgcagg       c.-121

 .         .         .         .         .         .                g.1237
 ttcgggggtggaatccttgggccgctgggcaagcggcgagacctggccagggccagcgag       c.-61

 .         .         .         .         .         .                g.1297
 ccgaggacagagggcgcacggagggccgggccgcagccccggccgcttgcagaccccgcc       c.-1

          .         .         .         .         .         .       g.1357
 ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG       c.60
 M  D  P  F  L  V  L  L  H  S  V  S  S  S  L  S  S  S  E  L         p.20

          .         .         .         .         .         .       g.1417
 ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG       c.120
 T  E  L  K  F  L  C  L  G  R  V  G  K  R  K  L  E  R  V  Q         p.40

          .         .         .         .         .         .       g.1477
 AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC       c.180
 S  G  L  D  L  F  S  M  L  L  E  Q  N  D  L  E  P  G  H  T         p.60

          .         .         .         .         .         .       g.1537
 GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC       c.240
 E  L  L  R  E  L  L  A  S  L  R  R  H  D  L  L  R  R  V  D         p.80

          .         .         .         .       | 02 .         .    g.3984
 GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAG | ACCTGTGTGCAGCA    c.300
 D  F  E  A  G  A  A  A  G  A  A  P  G  E  E  D |   L  C  A  A      p.100

          .         .         .         .         .         .       g.4044
 TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA       c.360
 F  N  V  I  C  D  N  V  G  K  D  W  R  R  L  A  R  Q  L  K         p.120

          .         .         .         .         .         .       g.4104
 GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT       c.420
 V  S  D  T  K  I  D  S  I  E  D  R  Y  P  R  N  L  T  E  R         p.140

          .         .         .         .         .         .       g.4164
 GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC       c.480
 V  R  E  S  L  R  I  W  K  N  T  E  K  E  N  A  T  V  A  H         p.160

          .         .         .         .         .         .       g.4224
 CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT       c.540
 L  V  G  A  L  R  S  C  Q  M  N  L  V  A  D  L  V  Q  E  V         p.180

          .         .         .         .         .         .       g.4284
 CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA       c.600
 Q  Q  A  R  D  L  Q  N  R  S  G  A  M  S  P  M  S  W  N  S         p.200

          .         .                                               g.4311
 GACGCATCTACCTCCGAAGCGTCCTGA                                        c.627
 D  A  S  T  S  E  A  S  X                                          p.208

          .         .         .         .         .         .       g.4371
 tgggccgctgctttgcgctggtggaccacaggcatctacacagcctggactttggttctc       c.*60

          .         .         .         .         .         .       g.4431
 tccaggaaggtagcccagcactgtgaagacccagcaggaagccaggctgagtgagccaca       c.*120

          .         .         .         .         .         .       g.4491
 gaccacctgcttctgaactcaagctgcgtttattaatgcctctcccgcaccaggccgggc       c.*180

          .         .         .         .         .         .       g.4551
 ttgggccctgcacagatatttccatttcttcctcactatgacactgagcaagatcttgtc       c.*240

          .         .         .         .         .         .       g.4611
 tccactaaatgagctcctgcgggagtagttggaaagttggaaccgtgtccagcacagaag       c.*300

          .         .         .         .         .         .       g.4671
 gaatctgtgcagatgagcagtcacactgttactccacagcggaggagaccagctcagagg       c.*360

          .         .         .         .         .         .       g.4731
 cccaggaatcggagcgaagcagagaggtggagaactgggatttgaacccccgccatcctt       c.*420

          .         .         .         .         .         .       g.4791
 caccagagcccatgctcaaccactgtggcgttctgctgcccctgcagttggcagaaagga       c.*480

          .         .         .         .         .         .       g.4851
 tgttttgtcccatttccttggaggccaccgggacagacctggacactagggtcaggcggg       c.*540

          .         .         .         .         .         .       g.4911
 gtgctgtggtggggagaggcatggctggggtgggggtggggagacctggttggccgtggt       c.*600

          .         .         .         .         .         .       g.4971
 ccagctcttggcccctgtgtgagttgagtctcctctctgagactgctaagtaggggcagt       c.*660

          .         .         .         .         .         .       g.5031
 gatggttgccaggacgaattgagataatatctgtgaggtgctgatgagtgattgacacac       c.*720

          .         .         .         .         .         .       g.5091
 agcactctctaaatcttccttgtgaggattatgggtcctgcaattctacagtttcttact       c.*780

          .         .         .         .         .         .       g.5151
 gttttgtatcaaaatcactatctttctgataacagaattgccaaggcagcgggatctcgt       c.*840

          .         .         .         .         .         .       g.5211
 atctttaaaaagcagtcctcttattcctaaggtaatcctattaaaacacagctttacaac       c.*900

          .         .                                               g.5240
 ttccatactacaaaaaattttctattcct                                      c.*929

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fas (TNFRSF6)-associated via death domain protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.