Fanconi anemia, complementation group A (FANCA) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the FANCA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering FANCA transcript NM_000135.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .                                                         g.15
 CTCTGCCACGTGTGA                                                    c.15
 L  C  H  V  X                                                      p.4

          .         .         .         .         .         .       g.75
 gaagctctttttcgggcaccgaggtattaactgcagcagaaaaagacgagcttttgttat       c.*60

          .         | 02         .         .         .         .    g.293
 cagttccacggggttgcc | ctgacccttgagctccaggctcctgccagctggaggtgaaac    c.*120

          .         .         .         .         .         .       g.353
 tgtgcttgtatccccagccacgaagagctggaccagcttcaagtacatgtccacagcaac       c.*180

          .         .         .         .         .      | 03  .    g.601
 atgcaggaaggcctcttccctgatggccgcgtcttcatggaagtaggagagaaga | ctgta    c.*240

          .         .         .         .         .         .       g.661
 aaaagcgaaaggcagcagcctggtgtgctgatccggggccacacggaggaggagccgccc       c.*300

          .  | 04      .         .         .         .         .    g.1161
 cagcctgaggt | cactctctgtcaactgaaagagtgccagccaggatatcttcctcttctc    c.*360

          .         .         .         .         .        | 05.    g.1925
 taaacactcgaggattgctgcacaaacgtggaaagcctttggcaggtctgtggtgct | att    c.*420

          .         .         .         .         .         .       g.1985
 tgaggtcagatgtgacgacagcaggcccatcaaggagaagaagaaaaggaaaaccaatag       c.*480

  | 06       .         .         .         .         .         .    g.3978
  | ctcctctctctcgcagtccagcttctttagctgcttcctgatgttttcttccctgacttg    c.*540

          .         .         .         .         .         .       g.4038
 ttgaatcgcaaagtgcagtgcagcagctgagagccagtccgggttgggtgctggggaggc       c.*600

          .          | 07        .         .         .         .    g.6118
 agcctcaggggagaggaaa | tcgctggcaaactgccggccttcttgtagcttctgcagttc    c.*660

          .         .         .         .         .         .       g.6178
 ccggggcagcgggctctggcagtgtctcctccaccggcagagcagcacaggctccaggct       c.*720

          .   | 08     .         .         .         .         .    g.7750
 cggccaccacac | cagagcagaggtcaaaattaaggggcatttcgtctggcacttggccag    c.*780

          .         .         .         .         .        | 09.    g.7952
 tatgaagtcgaccatcagggaggggtctctgctccgcagacaggcgttcaggaggcc | cct    c.*840

          .         .         .         .         .        | 10.    g.9780
 gaagaagtgggcagtgatgtcctgtgtcagggcacctccgtgggagcagaagtttct | cat    c.*900

          .         .         .         .         .         .       g.9840
 ctcagagttgaccaagtggaagaactgctcgcatctggcagtgatgggctgttctgcctg       c.*960

          .         .         .         .       | 11 .         .    g.10862
 gaagctgctgccgcagaggacagacgaaggcaggcggaggaggatc | cgtttgtacattag    c.*1020

          .         .         .         .         .         .       g.10922
 cagctccctctgtctctgaaggctggcagccacgctccacccgcttgtcagagcctggag       c.*1080

          .         .         .         .         .         .       g.10982
 ccgtctgcggaaaatctcaaagaggaagtgctcctgggaaggggtgtggccgagaggcac       c.*1140

          .         .         .          | 12        .         .    g.13277
 tatgaggtcttgctgcagctccaggtcagctaccatctc | ctgcaatctggaaataatatc    c.*1200

          .         .         .         .         .         .       g.13337
 ctcatttcctgtgcggccaccaaagaccaaatcagaattttctgagtggtcataactcct       c.*1260

      | 13   .         .         .         .         .         .    g.19751
 tgag | ctttggtggaaatccatcagtgcgttgacaagaatggtacacgcagcctgcaggtc    c.*1320

          .         .         .         .         .         .       g.19811
 tccgtcacagccccctgaagccgaggactcagggagaaagtgctcatggatcgcccactg       c.*1380

          .    | 14    .         .         .         .         .    g.23114
 gtggaagtcctgc | cgttcagtatctgaaagagcatcagcttcaggttgaatttccagctc    c.*1440

          .         .        | 15.         .         .         .    g.26041
 caggtgtaaccagtcttggtaagttaa | gtgaacatcttcctctttcaacacctctcggaa    c.*1500

          .         .         .         .         .         .       g.26101
 ggttctgtgtgtccagagagagagggcagctctctgccagtctgcagaaggaaggtgcaa       c.*1560

          .         .         .         .         .         .       g.26161
 gggtctccaggaaaggctggctacgtcctcctcagaaagaggctgtcgggcctctgagaa       c.*1620

          .         .     | 16   .         .         .         .    g.28295
 caatctgaacatgaggaactgaaa | ctttttaataaggcctggagataagcagctgcacaa    c.*1680

          .         .         .         .         .         .       g.28355
 agtatctcgtgactgggaagaaaacttgcagagagagtaagaaattgctgctgtacaaaa       c.*1740

   | 17      .         .         .         .         .         .    g.31014
 t | ttcaggcagaagaacaaggaatccctcgtcctacaggtcaggaggctgtcaaagagcgc    c.*1800

          .         .         .         .         .         .       g.31074
 agggacaggaaggccagcaccaggtgcaggaggacccacatccacctctgggagcgcaga       c.*1860

          .         .         .         .         .         .       g.31134
 cctggactcacccaggtgcacggccagggcagccaaccccagcacatgtggggcactcag       c.*1920

           | 18        .         .         .         .         .    g.31335
 gctcgggcc | ctggtgacggagcagctggcagagccgggtgagcactgcagggagcacacg    c.*1980

          .         .         .         .    | 19    .         .    g.31699
 tccacacatggtcctcacgaagagggcagcccagggaccctgc | ctctccgggggagcgac    c.*2040

          .         .         .         .         .     | 20   .    g.32802
 actggaggcagccatcaggttctgacagaaagacgtcagcaggaggtccacagc | catgtg    c.*2100

          .         .         .         .         .         .       g.32862
 ttcccgtggctccagtctcggcgtgttgatgctgagctgaatctttgatatctcaacgct       c.*2160

          .         .         .         .         .         .       g.32922
 gctgtcatcctcattgtggcccaggacagccctcagtctttcagaaatcactgccacctg       c.*2220

          .  | 21      .         .         .         .         .    g.34438
 tgccgatataa | catcacgctggctggggtctgtcatggaggctctcagctctcccagtgc    c.*2280

          .         .         .         .         .         .       g.34498
 agctgtgagctgtcccaggggctcctcagcagagttgggttctgccctcactcccagggc       c.*2340

       | 22  .         .         .         .         .         .    g.36915
 tgcat | cttctggcttctcttcagcagcagagcaggcctggcagtaggtggagtacagaga    c.*2400

          .          | 23        .         .         .         .    g.39960
 tggggggattttatctgct | ctcttcagagactctataaacgccacacgggagtcagggac    c.*2460

           | 24        .         .         .         .         .    g.40112
 tttggggag | cactcgaggtgtgagcagggcggggaggaagtgggacacgtagtaaggcct    c.*2520

          . | 25       .         .         .         .         .    g.41037
 cctgaatatg | ctggcctccatgacggtgactgggatgttccccgtatgctcaaacaccat    c.*2580

          .         .         .          | 26        .         .    g.43998
 gatggccttttcaacatcctgaagagcttggctgtgggg | ctcagtaatgtccccagctga    c.*2640

          .         .         .          | 27        .         .    g.44146
 tgacaaatcctcgtagagtcccatgttttctatagaaac | cttgaggtcggccagccgtgt    c.*2700

          .         .         .         .         .         .       g.44206
 cttggccaatgagatgtagtctgtgaggagggagcggtacttgccgggaaccaggggtgg       c.*2760

          .      | 28  .         .         .         .         .    g.46017
 gtggagaatgtgcac | ctgcaggtaccggggagactcaaaaggcacgagttctgacaagaa    c.*2820

          .         .         .         .         .         .       g.46077
 cgtaaacaggaagaccagggccttcttgctgcagccatggtagcctcgtgtgctcccaaa       c.*2880

        | 29 .         .         .         .         .         .    g.52575
 ggaggc | cttgaaccagtctgcatatgacaggaacgcagaggggccctccagtgctgcctg    c.*2940

          .         .         .         .         .         .       g.52635
 gcgcacaaccaggaacgcagtgaccatgctgtccagctggcagctctcgaatgcctgggc       c.*3000

          .         . | 30       .         .         .         .    g.53085
 catcaaacgcgccacccagt | cttcaagcagctgctgcgcttctggaaagcagacaaccag    c.*3060

          .         .         .         .         .         .       g.53145
 ggcagacacaaaggagagcactctctgccagtgaacctcctgcgtttccagaacttcttg       c.*3120

          .         .         .         .   | 31     .         .    g.53607
 caaatggccaaccaactcctctgcactcagcatcacaaagag | cctgcggtacagtgaggt    c.*3180

          .         .         .         .         .          | 32    g.57025
 gagcagagggtgtgtccgcgcaaagctccactctctctgcatctgaacagcatcagatg | c    c.*3240

          .         .         .         .         .         .       g.57085
 tttcagcacagggctgtgagtgagtatctgagtcagggtatgactgaagaacctcttcag       c.*3300

          .         .         .         .         .   | 33     .    g.60292
 aggatctgtggaaattacactgccaagcgtgtgtccactgaacactccgaac | cagcacct    c.*3360

          .         .         .         .         .          | 34    g.60724
 cacgatcttgtgagtggaggactcctcctgtactccagcagccaaagcgtcaagtgcaa | a    c.*3420

          .         .         .    | 35    .         .         .    g.64404
 aatcagcattctctgcagtacatcaaccgtgac | ctgcggcattttttcaggctccacagt    c.*3480

          .         .         .         .         .       | 36 .    g.66402
 tcttctcagatctgagtttttctgaaatcccctcaaaacaaacatttgaacaaaat | caga    c.*3540

          .         .         .         .         .         .       g.66462
 aagcatggccctggcgacgtcagcatgctggcaggatgcttccatctgttcacaaaggca       c.*3600

          .         .         .         .          | 37        .    g.69423
 gcacagattcctgaagagccacgatcccacagcatgcatgtcgggatgg | ctttccagcag    c.*3660

          .         .         .         .         .         .       g.69483
 ctcttgcaggctcacaatgccttgtacgtgaagatgccacaccgcttcaagcaacaaaga       c.*3720

     | 38    .         .         .         .         .         .    g.71882
 act | ctgtattttccataattcttgacagaaggaaagacgggagaacatactgtgtgccaa    c.*3780

          .         .         .          | 39        .         .    g.72068
 taaatactgagcaaactctaacagggaagacagcttctt | tctctgctccacagtcagcag    c.*3840

          .         .         .         .         .         .       g.72128
 cacagggtgactggtctccgctggagccgtgcagatctgtcccacgctagaggcaaccat       c.*3900

          .         .         .         .         .         .       g.72188
 cccggctgagagaatacccacgggaacccccagccttgaggcttgatcctgcaaagcaga       c.*3960

    | 40     .         .         .         .         .         .    g.75696
 gc | ctataaatgaactagaatgattagcataggcctcagaactgtcacagtcaatcacttt    c.*4020

          .         .         .       | 41 .         .         .    g.77019
 gctgagagacaattttttacacagtggaccttctac | ctcaagcaaaagggcattcaggtc    c.*4080

          .         .         .         .         .         .       g.77079
 ctgatggcttcgcaggaggcgcacagctgattcctttaatttctgtgccctttcaggatt       c.*4140

          .         .       | 42 .         .         .         .    g.77689
 atatttttccctcttgacccttcccg | ccagcagctcggcccaggccctccggcggccccc    c.*4200

          .         .         .         .         .         .       g.77749
 tgggtcctggcccgaggcggagttcgggacccacgagtcggacatggccttggcgcctac       c.*4260

          .         .        | 43.         .         .         .                                    g.77809
 agccccggcggcggctccctgcgcccg | a                                    c.*4288

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fanconi anemia, complementation group A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.