Fanconi anemia, complementation group C (FANCC) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the FANCC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering FANCC transcript NM_000136.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CAGGGTGATGACATCCCAGGCGATCGTGTGGCCTCCAGGAGCCCAGAGCAGGAAGTTGAG       c.60
 Q  G  D  D  I  P  G  D  R  V  A  S  R  S  P  E  Q  E  V  E         p.20

          .         .         .         .         .         .       g.120
 GAGAAGGTGCCTGATCAGCTGTTGTGCAGGAGCTCTGAGGTCTGTGTCTGTGCCCTGTCC       c.120
 E  K  V  P  D  Q  L  L  C  R  S  S  E  V  C  V  C  A  L  S         p.40

          .         .                                               g.147
 TGCTACCGTCTGCAGGTCCTGGGCTGA                                        c.147
 C  Y  R  L  Q  V  L  G  X                                          p.48

          .         .         .         .         .        | 02.    g.4400
 gaggctgctgcttctggacattgccaggaggtggcccagcacggccttcacctggac | cat    c.*60

          .         .         .         .         .         .       g.4460
 agtctgtgctctctgctgcctcccatcacgggggccgtagtagaaggccaagagccacag       c.*120

          .         .         .         .         .         .       g.4520
 cagggccgtggggggttcggctgccgacatcagtaattgctctgccaccatctcagccca       c.*180

          .         .         .         .         .   | 03     .    g.7571
 tcctccgaagtgaatgaacaggaaccagctctcaaagggacctccgcaggac | ccatgagt    c.*240

          .         .         .         .         .         .       g.7631
 ctggtcttcaactgcttctctgagcagttcagaaatatgcttcagtgtctggagccagtg       c.*300

          .     | 04   .         .         .         .         .    g.10295
 tccccgagggatat | cttgagggtcttgcagcagcaccatggcaagagatggagaagtgta    c.*360

          .         .         . | 05       .         .         .    g.18050
 aggaaagtaggtcttgagtgcaaaccgcag | ctgcttgcttgctttctccagagcttctac    c.*420

          .         .         .         .         .         .       g.18110
 aaagcactgcgtaaacacctgaatagtggctatgatttccagggccccatcggtttccag       c.*480

          . | 06       .         .         .         .         .    g.19513
 gagtgcacac | ctgaacatctcatcaacaacccggaatatggcagggtggcaggctgcttg    c.*540

     | 07    .         .         .         .         .         .    g.28337
 agg | cagcgatgaatcttttataaagcattcgatccttctcagacaatttctctcactgga    c.*600

          .         .         .         .         .         .       g.28397
 gattagcttttcaaaaagatgcagcattgctttttcaaggctgggaaggtgccgaagcca       c.*660

          .         .         .         . | 08       .         .    g.42877
 gaggcagactacagctgacatggggagagaaatcttcttc | agcaaaatggcctcgtttac    c.*720

          .         .         .         .         .         .       g.42937
 agcctcaaagaactctggctggaggatttcctgaggttcacgtccatgacagatgaggag       c.*780

          .         .         .         .         .         .       g.42997
 agcctccaccagggggtcaacatctgtcagggtaataagtgggacacaaactcgtgacag       c.*840

          .         .      | 09  .         .         .         .    g.64048
 ggacgccactcgctcgggagccatt | cgcctttgagtgttaaatccattaagatgattctc    c.*900

          .         .         . | 10       .         .         .    g.65001
 tctgagttcagacgctaatgataaaaccat | atttttaagcaaaccaggatagtaatctat    c.*960

          .         .         .         .         .         .       g.65061
 aggtgcatacccaagaccttgagtgaaaagagcaacttctttatcaaatctgagtgctga       c.*1020

          .         .  | 11      .         .         .         .    g.133622
 aagtatatgagataatacacc | ctgtatccaggagttaagttttgattgtccagaattctg    c.*1080

          .         .         .         .         .       | 12 .    g.140370
 tggttctttgttaattagacaacataagcaccatattagaattttttggctttcat | cata    c.*1140

          .         .         .         .         .         .       g.140430
 tgctaaaataaaaggattccaacaagcttttgccaacagttgaccaattgtggggaatct       c.*1200

          .         .  | 13      .         .         .         .    g.142100
 ttcaatgactgtattagaatc | catctctttcaaggcttcatacatcttccttaggaactc    c.*1260

          .         .         .         .         .         .       g.142160
 ctggaactgagccacgtgaagacaggtgtcttgctgggtttccaaagtggaagcctgatc       c.*1320

          .         .         .         .         .         .       g.142220
 ccatacagaaagcttctgcatccaaaactgataatcacaagaaagatctactgaatcttg       c.*1380

          .         .         .         .         .         .       g.142280
 agccatcttggaaaaagcgaaaaggtgatgtcccttcacagcagcctgtccagcactgaa       c.*1440

          .         .     | 14   .         .         .         .    g.210496
 ggaaatggtcggcacacattaaat | cgggtggtcctcgcgggagctgcttcagcagtttgg    c.*1500

          .         .         .         .         .         .       g.210556
 gcagtggcggaaaggaagccaccgcccgggatctgtggcttgaaaatttggctttgcctc       c.*1560

          .         .         .         .         .         .       g.210616
 gtattggctttttgagtttttttggaattttcccgcggtcgcccggcagtggagccgcgc       c.*1620

          .         .         | 15         .         .         .                                   g.210676
 gcgcgcacacgtgtcagcagtgcattct | c                                   c.*1649

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fanconi anemia, complementation group C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.