Fanconi anemia, complementation group G (FANCG) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the FANCG gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering FANCG transcript NM_004629.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CACAGAGCATCTTCATGTGACCCCTTAGTTTGGGCCTCCAGCCTCCACCAGAGTGCAGTG       c.60
 H  R  A  S  S  C  D  P  L  V  W  A  S  S  L  H  Q  S  A  V         p.20

          .         .         .                                     g.96
 GCCTCATCCCTCCGATCTAGCCTCTTCAGAGTCTGA                               c.96
 A  S  S  L  R  S  S  L  F  R  V  X                                 p.31

          .         .         | 02         .         .         .    g.588
 agcaggtgaaagtaagtgtctcgattac | ctgggcacatctgcacactgaggaggaagtcc    c.*60

          .         .         .         .         .         .       g.648
 tgtaaggctttggtatcctggccgctggctacccattccagtccacgactaattagggcg       c.*120

          .         .         .         .         .         .       g.708
 gctgcccgaagctgctgcagtgccgcatctgacttacatccctgctcacagttgaaagct       c.*180

      | 03   .         .         .         .         .  | 04      . g.1103
 gccc | cttgttctttttcctcaggtgtggcccggaagagcagctcgaggcac | ctgctaaat c.*240

          .         .         .         .         .         .       g.1163
 tcactaattgccactttttgggcacccagttgaacccaggcctggccctgaagcaggtgg       c.*300

          .         .         .         .         .         .       g.1223
 gtggcagagacccagagtgggcagtatggcagttccttggttccttttctggcatcttcc       c.*360

          .         .         .         .         .         .       g.1283
 cacagccgggacatcttgggtagcagagatgatgtgcggctgagcaactcctcacataga       c.*420

          .         .         .         .         .         .       g.1343
 gtcaaggcatcttgggctctgcctgcctggatcagtgctaccgctgcctccaaaaacacc       c.*480

          .         .         .         .  | 05      .         .    g.1610
 tcaggcatacagggccctggaggggaggggggtggggagaa | ccttggctccgagctatcc    c.*540

          .         .         .         .         | 06         .    g.2073
 agcaacagggccagcaggtccaagtaatgctctgcagcgtctcctgcc | ctccccgtctgt    c.*600

          .         .         .         .         .         .       g.2133
 aggcacctgcttgctagtatgtgcttggtctggctctgagtgccacaatgaaggggtgag       c.*660

          .         .         .         .         .         .       g.2193
 gctaggtcaggtggtggcagtagtaattctacctcaatgagaaactgcggggctttggaa       c.*720

          .         . | 07       .         .         .         .    g.2393
 ctgcatgggacattcaaggc | ctcaactagcagctccagactctccagctctgctgttgtg    c.*780

          .         .         .         .         .         .       g.2453
 tcccccagttgctgatagagcctagaggcctccagaagtggaggaccccaggctgatccc       c.*840

          .         .         .         .        | 08.         .    g.2613
 tctttcagggctgcaaccaagtacaacagtgctctctgtggatttcc | catcttacggtga    c.*900

          .         .         .         .         .         .       g.2673
 caggaccccagtgctgtgtacacctggaccaacacaggccgtggacacaggcctgaggcc       c.*960

          .         .         .         .         .         | 09    g.2895
 gcttcatgaaggctgcttagtgccttgtctgggttccctgtgatcagctcctggagac | ct    c.*1020

          .         .         .         .         .         .       g.2955
 tggcggtaggcaaatgctgtcaggaggacatccttcaatccctgggcatcctgcagggtc       c.*1080

          .         .         .         .         .         .       g.3015
 aatggagcatctaattcctcagctgggggactccaagttttcagaagtaacagcagatcc       c.*1140

          .     | 10   .         .         .         .         .    g.3816
 ttagaggctccact | ctggctgccattcagggtctctagtaacaaggccaggtccccaaga    c.*1200

          .         .         .         .         .         .       g.3876
 cggtcagcactcaaccagagggcagcctgcaggccaaccaggcggtgcagggcagacagc       c.*1260

          .         .         .         .         .         .       g.3936
 agctccggcagaaggcaggaagcacgaaggacagagtcccacagctccctgagcccctgt       c.*1320

          .         .         .        | 11.         .         .    g.4257
 tccaacctgggcccctgctgctcctgtgtctccagca | ctctctctaggctccgctggata    c.*1380

          .         .         .         .         .         .       g.4317
 tcctgggcctgatcctctgtgaaaccctgggccaagcttgccctcaggataatgaagttg       c.*1440

          .         .         .         .          | 12        .    g.4791
 caggtgacagtcagctccaagggaagaacaggaacagctgcagggagcc | cttgcagacta    c.*1500

          .         .         .         .         .         .       g.4851
 tggaggagccctctgagcccttccagtgcatcctgagccaactgctgtcgcctcagagtc       c.*1560

          .         . | 13       .         .         .         .    g.5110
 agaccggagttctgagccac | cttggcctgtcgaacgagccggtcattcttttccctccac    c.*1620

          .         .         .         .         .         .       g.5170
 aggtccaggcagctggagcccacagaggtggtctggcgggacatggtggccgaggctggg       c.*1680

          .         .         .         .         .         .       g.5230
 cccggagaccagaagcggacttaggaagggtgaagctggcctgcccaagctcccaacccc       c.*1740

          .         .         .         .         .         .       g.5290
 agcggggaggggcctgggcacttctgcaccccgccgagctcccctgcttctctcggggtc       c.*1800

          .         .         .         .         .         .       g.5350
 ccaatccacccgcccaggctttccaggacagatgggacgctctctccccgcggcccgccg       c.*1860

          .         .         .         .         .         .       g.5410
 ggctctcaacctcgcctctggttggccgggtctgcgaagctctgggctgcggttggtcct       c.*1920

          .         .         .         .         .         .       g.5470
 cttgaagagttagttcccgcgggaaactcggggaggaaacgagtcagcaaccccaaacag       c.*1980

          .         .         .         .         .         .       g.5530
 gcttaggcgggctagaagccggggtcgtgtctgactggggcagtcgcacggccggcggtg       c.*2040

          .         .         .         .         .         .       g.5590
 cggcccgctcggctctcgcggaggccacagcctcgagaaagggtgggcgggagcgagttt       c.*2100

          .         .         .         .         .       | 14 .       g.5650
 cggccccacagtccgtggctcggcccttcctcgctgccacacccccaggtcctcct | g       c.*2157

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fanconi anemia, complementation group G protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.