ficolin (collagen/fibrinogen domain containing) 3 (FCN3) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the FCN3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering FCN3 transcript NM_003665.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTGCAGTGCCCTCTGAGAACTTGCCCAGTGCCAGCTGGTAGTGGTCTACCTCACCGAGGA       c.60
 L  Q  C  P  L  R  T  C  P  V  P  A  G  S  G  L  P  H  R  G         p.20

          .         .         .         .                           g.102
 GGCGGAAGGTCGCATAGTGGGCGAAAGTACGGTTACCATTAA                         c.102
 G  G  R  S  H  S  G  R  K  Y  G  Y  H  X                           p.33

          .         .         .    | 02    .         .         .    g.274
 agtcttccagctctacccgcagctcccagttac | cctggagagtaagctggtgcaaattct    c.*60

          .         .         .         .         .         .       g.334
 catttcccagccagaattcagactcttggttcccaaaacctgctctgtaggaggaccaag       c.*120

          .         .         .         .    | 03    .         .    g.2557
 agcggaagaaatccacagaaccatcctggcgcctctgaaacac | cagccagccgcccccct    c.*180

          .         .         .         .         .         .       g.2617
 cggtgtccatgtcacaaaagactgggagggccctgccctcaggtaggcacagatggtacc       c.*240

          .         .         .         .         .  | 04      .    g.2901
 agccgctcaaggtggcgccctggctcaacagctcccggcagtttctggggc | cttcctggc    c.*300

          .         .     | 05   .         .         .         .    g.3405
 accggagcaggttcactggatctc | ctggctcacccttggggcccatcttgcctggtggtc    c.*360

           | 06        .         .         .         .         .    g.3811
 caggtggcc | cttgaggacctggggctcccttctccccaggacttcctggagctccgggac    c.*420

          .         .         .         .      | 07  .         .    g.4147
 aactgggcaggaggacaactttgctggcttccagttccctgggtc | ctgggcagctggggt    c.*480

          .         .         .         .         .         .       g.4207
 gttcctgggtcttcaggcaggcaggccccccaagcaggagaagccacagggagggcagga       c.*540

          .         .   | 08     .         .         .         .                                         g.4267
 tccacagtagatccatcttgct | c                                         c.*563

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ficolin (collagen/fibrinogen domain containing) 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.