formyl peptide receptor 1 (FPR1) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)


This file was created to facilitate the description of sequence variants in the FPR1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering FPR1 transcript NM_002029.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.7068
                                     ctggactgttcaccagctgtggtc       c.-61

 .         .         .         .         .         .                g.7128
 ttgctctgggtagttctaggtctgggtctcctggggagagtgactcaggctctaatgatt       c.-1

  | 02       .         .         .         .         .         .                                                               g.7188
  | A                                                               c.1
  | ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?  ?      p.0

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Formyl peptide receptor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center