(intronic numbering for coding DNA Reference Sequence)
. . . . g.5703
ctgagggcagggcacagctgtaaccagtgcgggcagggcaggaccagg c.1299+48
--------------------- middle of intron ---------------------
g.5704 . . . . g.5750
c.1300-47 cctgtccctggcgggaggtcacaggggcagtggtgggacacacttac c.1300-1
Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center