GATA binding protein 2 (GATA2) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the GATA2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering GATA2 transcript NM_032638.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATTGTGCAGCTTGTAGTAGAGGCCACAGGCGTTGCAGACAGGGTCCCCGTTGGCGTTTCG       c.60
 I  V  Q  L  V  V  E  A  T  G  V  A  D  R  V  P  V  G  V  S         p.20

                                                                    g.69
 GCGCCATAA                                                          c.69
 A  P  X                                                            p.22

          .         .         .         .         .        | 02.    g.2044
 ggtggtggttgtcgtctgacaatttgcacaacaggtgccggctcttctggcggccga | cag    c.*60

          .         .         .         .         .         .       g.2104
 tcttcgcttgggcttgatgagtggtcggttctgcccattcatcttgtggtagaggccaca       c.*120

          .         .         .         .         .         .       g.2164
 ggcattgcacaggtagtggccggtgccgtcccgccgccagagaggggtggctgtggcccc       c.*180

          .         .    | 03    .         .         .         .    g.3945
 acagttgacacactcccggcctt | ctgaacaggaacgagccttgctgcgctgcttaggggt    c.*240

          .         .         .         .         .         .       g.4005
 gaagctggaggccggtccccccaggaagcctccggggtggaagagtccgctgctgtagtc       c.*300

          .         .         .         .         .         .       g.4065
 gtgggcagccgccggcacataggaggggtaggtggggatggggtggtgtgtagcaggctg       c.*360

          .         .         .         .         .         .       g.4125
 ggtgcccatagtagctaggcctgggcgcaggggactgccactttccatcttcatgctctc       c.*420

          .         .         .         .         .         .       g.4185
 cgtcagtgacacctggtacttgacgccgtccttgtcctctcctcgggctgcactaccccc       c.*480

          .         .         .         .         .         .       g.4245
 cgcggaagatgaggctggagacgcagcccccgtggtgctagggtcaggagacacttcttt       c.*540

          .         .         .         .         .         .       g.4305
 gggtggcgtgggtgggaagccgaaaaggtgggagccagagtgggctgctgtaggggtgag       c.*600

          .         .         .         .         .         .       g.4365
 ggaggccactgagctcccgctgcctcccccgctcccacccccagcccctgggtacacaga       c.*660

          .         .         .         .         .         .       g.4425
 gagtgggcctccagggcctccagcagctgaggggtgcagtggcgtcttggagaaggggct       c.*720

          .         .         .         .         .         .       g.4485
 cacggtccaggggttgtggtggtgggccgcagcggcagagagggctgctttgcccccgtc       c.*780

          .         .         .         .         .         .       g.4545
 cagccagggcaaacccgggctgtgcaacaagtgtgggcggcacatctggcctccggtcag       c.*840

       | 04  .         .         .         .         .         .    g.5039
 gcggg | cgtgcgcggggctgtaggagacgcgcgcccgcgcgtgagcggggttggcatagta    c.*900

          .         .         .         .         .         .       g.5099
 ggggttgccctgcgagtcgaggtgattgaagaagacgtccacctcgtctggaggcagcag       c.*960

          .         .         .         .         .         .       g.5159
 ctgcgcgggttccatgtagttgtgcgccaggcccgggtggtgtgagtcggggtgctgcgc       c.*1020

          .         .         .         .         .         .       g.5219
 attcagcacggccgggtgcgccatccagcgcggctgctcgggcgccacctccatggccgg       c.*1080

          .         .         .          | 05        .         .    g.11101
 cggcggcggctcagggtctgggtgcagacggcaacggcc | cgagcgaggcgcggtgggcgg    c.*1140

          .         .         .         .         .         .       g.11161
 cgcccccgggcggacggggcctggagtagagctgggagcagggcgaggtgcgcggcaggc       c.*1200

          .         .         .         .         .         .       g.11221
 gggctcgcgggacctgggcgcggggtggcggcgctcaccagcagagcctgggcggcacgc       c.*1260

          .         .         .         .         .         .       g.11281
 cgagcggccgcatggtgttcagcggaccgcttttgtccgcctggtgggcgacggggccct       c.*1320

          .         .         .         .         .         .       g.11341
 gctaggatggatgtggcggcaggcaatagacagacttgagcagcgagtcccggggcgacg       c.*1380

          .         .         | 06         .         .         .                                   g.11401
 ctggcctcgctaccttcctggcgctcac | t                                   c.*1409

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The GATA binding protein 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.