Hermansky-Pudlak syndrome 4 (HPS4) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the HPS4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000022.10, covering HPS4 transcript NM_022081.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .                                                         g.18
 CTGACAGTCATTTCATAA                                                 c.18
 L  T  V  I  S  X                                                   p.5

          .         .         .         .         .         .       g.78
 agcgcgggcagctgggcaaattcgctatgcatcaggctgacggcctggaggaagcggcga       c.*60

          .         .         .  | 02      .         .         .    g.615
 tcctgcggggtggccacctgcggcaggtttg | ccatcagcaagctctgaatgcggtcgtaa    c.*120

          .         .         .         .         .         .       g.675
 tgtgtgaagttgtaggtgctgctcgtggaggctgcctcatccctgggcagcgtctctttc       c.*180

          .         .         .         .     | 03   .         .    g.6074
 aggtggacttccagcccattcagtgaagccaggctgctgtggta | cacttcctctatggct    c.*240

          .         .         .         .         .         .       g.6134
 gcgctgtctcccagcagcggctcctcagccagcagggacagcaccagccctttgacgcag       c.*300

          .         .         .         .         .         .       g.6194
 tgagtgtagagattcatcctcacgagccccatgcaggactctgctggtgtcagcctggag       c.*360

          .         .         .         .         .         .       g.6254
 ctgattccatctgcagaggggccagcaccctgacagtttgctgagcctgaactgcattcc       c.*420

          .         .         .         .         .         .       g.6314
 agaccaggggctgcgtggctttcacagaccccatcaacatcctcatccaggccttgttcc       c.*480

          .         .         .         .         .         .       g.6374
 cccgtgggaagcttgtttcctctctgtcctggatctaagcgaggcaataacaagggcctg       c.*540

          .         .         .         .         .         .       g.6434
 cgggtccttctggggagagggtctgctctgggaatgggggcttggctgctatggccagga       c.*600

          .         .         .         .         .         .       g.6494
 tggtcttcgagctgctcttgggctccatgctgggtcagcatctcaggagcagagggaggg       c.*660

          .         .         .         .         .         .       g.6554
 cgcaagctgctgatggctgtgtcctcaggaggcgtgggttccaggctgctggaggcgctg       c.*720

          .         .         .         .         .         .       g.6614
 agagatgccttgcagtaaggagccctgccatctggaacaggcacatgtaggaaggcaaaa       c.*780

          .         .         .         .         .         .       g.6674
 tgacctgaggccatttccacttcctgagcctctggaatgtggatttcagacaagtcgagt       c.*840

          .         .         .         .         .         .       g.6734
 tcttcttggagaaagactagttccttccccagggaggagctgaggccaagaacctcaccc       c.*900

          .         .         .         .         .         .       g.6794
 ctggcagagttgtgcagtcctgcgggcctgatgctctccagatcatggccagacaagcat       c.*960

          .         .         .         .         .         .       g.6854
 ccgttctccttcctgccatctggacaagcttcgtcaggggatgtgggatctggggtggtc       c.*1020

          .         .         .         .         .         .       g.6914
 caggccatggattccacatggccagtggcgttttctttcagggcagatgtgctcccaccc       c.*1080

          .         .         .         .         .     | 04   .    g.7602
 tttggatggtgctgggctgaaccatcctggagtcctgctggagatgctagagac | cttgtc    c.*1140

          .         .         .         .         .         .       g.7662
 atctgttccaccgggaactcgtggagactaatggcttcctctttggtcacaaaaacaggg       c.*1200

          .         .         .  | 05      .         .         .    g.8396
 ataatctggacattcgggggcaatgccgctc | catgttcctgcggggcatcctctcccgta    c.*1260

          | 06         .         .         .         .         .    g.10744
 gggagtct | ctgctcctgaggtgctgttcggtgaagcaggaccttggcggtgagggagggc    c.*1320

          .         .  | 07      .         .         .         .    g.12899
 gggagttgggtgctgacaatc | agtcctttatagaggatgcagccagcgagaatgtgaggc    c.*1380

          .         .         .         .         .       | 08 .    g.14447
 gagcgctggcaggtctgcagaatgcgggctgccttcagcaacaacaggggctccac | ttta    c.*1440

          .         .         .         .         .         .       g.14507
 gtttggtccaagttccagagggaattgaaaatcttatgcagatcactggtgtttttcaga       c.*1500

          .         .         .         .         .    | 09    .    g.14980
 atttgctcgatgaaggtgtcccactccgtgctcagttcttcctgagaacagtt | ctcataa    c.*1560

          .         .         .         .         .         .       g.15040
 gctagggaaacaggtccattgtaaaaattaaagaatccaactagctgatccagaaaccgc       c.*1620

          .         .         .         .  | 10      .         .    g.19153
 ttgcagctgacatcagggagctccacagcacagcccagcac | ccaaaggtaatctccatca    c.*1680

          .         .         .         .         .         .       g.19213
 acttttatggcaaacttcagttttctcagacgaacaagagtaggaggagagtcagaaatg       c.*1740

          .         .         .         .         .         .       g.19273
 tcagaaacacagcggacaactccagcaatctgtccacaaagcaactcctgttggtctagc       c.*1800

       | 11  .         .         .         .         .         .    g.21461
 agggt | ctgggaaggataaaagtaacaaatgccagctcttgttggatcgccttcttccttt    c.*1860

          .         .         .       | 12 .         .         .    g.23887
 accttggaaccatcataaagaaaaaaataattccac | cacgaggctgactttgcctctgtg    c.*1920

          .         .         .         .         .         .       g.23947
 gaggtagaggtggccatctactgtgcagtcatcctcattctcttcatttaggttttcttt       c.*1980

          .         .         .         .         .         .       g.24007
 tccggtatcacttctttctccctagctgtgaccgttcctctatcccccaatccagtgaat       c.*2040

          .         .         .         .         .         .       g.24067
 ctggacgtggtaggtttcagtgttttcagtcacaactgccacttggttagttttcactca       c.*2100

          .         .         .         .         .         .       g.24127
 gcatggaaagttccacttcccttccttgcaggttcttcagtttcatgtatatttccatgc       c.*2160

          .         .         .         .         .         .       g.24187
 ctcttacaactcagggagaaactataacagagaatcctagcagaaaagtcaaatccattc       c.*2220

          .         .         .         .         .         .       g.24247
 ctctggtttcctaagtatcactgtggctgtctgcagaaccacctcttcaagctcctctcc       c.*2280

          .         .         .         .         .         .       g.24307
 aggaaagccaaaagtgggagatgcatgctagagctggtgttctaaagaaatttctagctt       c.*2340

          .         .         .         .         .         .       g.24367
 gtctagttcaaacccatcctgaagactcttattaaacgttttgaagtttccagttcaaac       c.*2400

          .      | 13  .         .         .         .         .    g.25860
 atcagtgccttggct | cggagtagccaggcatcccagtgctcggggttcgggactctggac    c.*2460

          .         .         .         .         .         .       g.25920
 cagaaatgtgggcagcagctgggtacctgcgacttctgccccgtacctgcgcgcgcggca       c.*2520

          .         .         .         .         .         .       g.25980
 gagaggccttaggtcacgcgccgccccgcctacctccccctccagctcctggcaagccgg       c.*2580

          .       | 14 .         .         .         .         .                                               g.26040
 cgcgcggcgatgacgt | a                                               c.*2597

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Hermansky-Pudlak syndrome 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.