inducible T-cell co-stimulator (ICOS) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the ICOS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering ICOS transcript NM_012092.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.1024
                                                      cgagagc       c.-61

 .         .         .         .         .         .                g.1084
 ctgaattcactgtcagctttgaacactgaacgcgaggactgttaactgtttctggcaaac       c.-1

          .         .         .         .         .         | 02    g.19907
 ATGAAGTCAGGCCTCTGGTATTTCTTTCTCTTCTGCTTGCGCATTAAAGTTTTAACAG | GA    c.60
 M  K  S  G  L  W  Y  F  F  L  F  C  L  R  I  K  V  L  T  G |       p.20

          .         .         .         .         .         .       g.19967
 GAAATCAATGGTTCTGCCAATTATGAGATGTTTATATTTCACAACGGAGGTGTACAAATT       c.120
 E  I  N  G  S  A  N  Y  E  M  F  I  F  H  N  G  G  V  Q  I         p.40

          .         .         .         .         .         .       g.20027
 TTATGCAAATATCCTGACATTGTCCAGCAATTTAAAATGCAGTTGCTGAAAGGGGGGCAA       c.180
 L  C  K  Y  P  D  I  V  Q  Q  F  K  M  Q  L  L  K  G  G  Q         p.60

          .         .         .         .         .         .       g.20087
 ATACTCTGCGATCTCACTAAGACAAAAGGAAGTGGAAACACAGTGTCCATTAAGAGTCTG       c.240
 I  L  C  D  L  T  K  T  K  G  S  G  N  T  V  S  I  K  S  L         p.80

          .         .         .         .         .         .       g.20147
 AAATTCTGCCATTCTCAGTTATCCAACAACAGTGTCTCTTTTTTTCTATACAACTTGGAC       c.300
 K  F  C  H  S  Q  L  S  N  N  S  V  S  F  F  L  Y  N  L  D         p.100

          .         .         .         .         .         .       g.20207
 CATTCTCATGCCAACTATTACTTCTGCAACCTATCAATTTTTGATCCTCCTCCTTTTAAA       c.360
 H  S  H  A  N  Y  Y  F  C  N  L  S  I  F  D  P  P  P  F  K         p.120

          .         .         .     | 03   .         .         .    g.20954
 GTAACTCTTACAGGAGGATATTTGCATATTTATG | AATCACAACTTTGTTGCCAGCTGAAG    c.420
 V  T  L  T  G  G  Y  L  H  I  Y  E |   S  Q  L  C  C  Q  L  K      p.140

          .         .         .         .         .         .       g.21014
 TTCTGGTTACCCATAGGATGTGCAGCCTTTGTTGTAGTCTGCATTTTGGGATGCATACTT       c.480
 F  W  L  P  I  G  C  A  A  F  V  V  V  C  I  L  G  C  I  L         p.160

          .         .  | 04      .         .         .         .    g.22107
 ATTTGTTGGCTTACAAAAAAG | AAGTATTCATCCAGTGTGCACGACCCTAACGGTGAATAC    c.540
 I  C  W  L  T  K  K   | K  Y  S  S  S  V  H  D  P  N  G  E  Y      p.180

          .         .         .         .       | 05 .         .    g.23869
 ATGTTCATGAGAGCAGTGAACACAGCCAAAAAATCTAGACTCACAG | ATGTGACCCTATAA    c.600
 M  F  M  R  A  V  N  T  A  K  K  S  R  L  T  D |   V  T  L  X      p.199

          .         .         .         .         .         .       g.23929
 tatggaactctggcacccaggcatgaagcacgttggccagttttcctcaacttgaagtgc       c.*60

          .         .         .         .         .         .       g.23989
 aagattctcttatttccgggaccacggagagtctgacttaactacatacatcttctgctg       c.*120

          .         .         .         .         .         .       g.24049
 gtgttttgttcaatctggaagaatgactgtatcagtcaatggggattttaacagactgcc       c.*180

          .         .         .         .         .         .       g.24109
 ttggtactgccgagtcctctcaaaacaaacaccctcttgcaaccagctttggagaaagcc       c.*240

          .         .         .         .         .         .       g.24169
 cagctcctgtgtgctcactgggagtggaatccctgtctccacatctgctcctagcagtgc       c.*300

          .         .         .         .         .         .       g.24229
 atcagccagtaaaacaaacacatttacaagaaaaatgttttaaagatgccaggggtactg       c.*360

          .         .         .         .         .         .       g.24289
 aatctgcaaagcaaatgagcagccaaggaccagcatctgtccgcatttcactatcatact       c.*420

          .         .         .         .         .         .       g.24349
 acctcttctttctgtagggatgagaattcctcttttaatcagtcaagggagatgcttcaa       c.*480

          .         .         .         .         .         .       g.24409
 agctggagctattttatttctgagatgttgatgtgaactgtacattagtacatactcagt       c.*540

          .         .         .         .         .         .       g.24469
 actctccttcaattgctgaaccccagttgaccattttaccaagactttagatgctttctt       c.*600

          .         .         .         .         .         .       g.24529
 gtgccctcaattttctttttaaaaatacttctacatgactgcttgacagcccaacagcca       c.*660

          .         .         .         .         .         .       g.24589
 ctctcaatagagagctatgtcttacattctttcctctgctgctcaatagttttatatatc       c.*720

          .         .         .         .         .         .       g.24649
 tatgcatacatatatacacacatatgtatataaaattcataatgaatatatttgcctata       c.*780

          .         .         .         .         .         .       g.24709
 ttctccctacaagaatatttttgctccagaaagacatgttcttttctcaaattcagttaa       c.*840

          .         .         .         .         .         .       g.24769
 aatggtttactttgttcaagttagtggtaggaaacattgcccggaattgaaagcaaattt       c.*900

          .         .         .         .         .         .       g.24829
 attttattatcctattttctaccattatctatgttttcatggtgctattaattacaagtt       c.*960

          .         .         .         .         .         .       g.24889
 tagttctttttgtagatcatattaaaattgcaaacaaaatcatctttaatgggccagcat       c.*1020

          .         .         .         .         .         .       g.24949
 tctcatggggtagagcagaatattcatttagcctgaaagctgcagttactataggttgct       c.*1080

          .         .         .         .         .         .       g.25009
 gtcagactatacccatggtgcctctgggcttgacaggtcaaaatggtccccatcagcctg       c.*1140

          .         .         .         .         .         .       g.25069
 gagcagccctccagacctgggtggaattccagggttgagagactcccctgagccagaggc       c.*1200

          .         .         .         .         .         .       g.25129
 cactaggtattcttgctcccagaggctgaagtcaccctgggaatcacagtggtctacctg       c.*1260

          .         .         .         .         .         .       g.25189
 cattcataattccaggatctgtgaagagcacatatgtgtcagggcacaattccctctcat       c.*1320

          .         .         .         .         .         .       g.25249
 aaaaaccacacagcctggaaattggccctggcccttcaagatagccttctttagaatatg       c.*1380

          .         .         .         .         .         .       g.25309
 atttggctagaaagattcttaaatatgtggaatatgattattcttagctggaatattttc       c.*1440

          .         .         .         .         .         .       g.25369
 tctacttcctgtctgcatgcccaaggcttctgaagcagccaatgtcgatgcaacaacatt       c.*1500

          .         .         .         .         .         .       g.25429
 tgtaactttaggtaaactgggattatgttgtagtttaacattttgtaactgtgtgcttat       c.*1560

          .         .         .         .         .         .       g.25489
 agtttacaagtgagacccgatatgtcattatgcatacttatattatcttaagcatgtgta       c.*1620

          .         .         .         .         .         .       g.25549
 atgctggatgtgtacagtacagtactgaacttgtaatttgaatctagtatggtgttctgt       c.*1680

          .         .         .         .         .         .       g.25609
 tttcagctgacttggacaacctgactggctttgcacaggtgttccctgagttgtttgcag       c.*1740

          .         .         .         .         .         .       g.25669
 gtttctgtgtgtggggtggggtatggggaggagaaccttcatggtggcccacctggcctg       c.*1800

          .         .         .         .         .         .       g.25729
 gttgtccaagctgtgcctcgacacatcctcatccccagcatgggacacctcaagatgaat       c.*1860

          .         .         .         .         .         .       g.25789
 aataattcacaaaatttctgtgaaatcaaatccagttttaagaggagccacttatcaaag       c.*1920

          .         .         .         .         .                 g.25847
 agattttaacagtagtaagaaggcaaagaataaacatttgatattcagcaactgaaaa         c.*1978

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Inducible T-cell co-stimulator protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.