interferon gamma receptor 1 (IFNGR1) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the IFNGR1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering IFNGR1 transcript NM_000416.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .                                                         g.15
 CAAGGACTTGGGTAA                                                    c.15
 Q  G  L  G  X                                                      p.4

          .         .         .         .         .         .       g.75
 tattatgcttttttccttcaatggattaattttcttaatataaaaacagatgaataccag       c.*60

          .         .         .         .         .    | 02    .    g.2625
 gctaagcactagaaagagtagtaaagcagcaacaactggaatccaaagagaac | cttttat    c.*120

          .         .         .         .         .         .       g.2685
 actgctattgaaaatggtaatacaaacttcttttgacttttcagttgtaacaccccacac       c.*180

          .         .         .         .         .         .       g.2745
 atgtaagactccttctgctgaaacacagtactgagaattcagtgaggatactggaatcgc       c.*240

          .         .         .         .         .         .       g.2805
 taactggcactgaatctcgtcacaatcatcttccttctgcgtgagtattttatactggat       c.*300

  | 03       .         .         .         .         .         .    g.3511
  | ctcacttccgttcattctcacatacacattgtacaccctaatgtaacaggtagtttcggg    c.*360

          .         .         .         .         .         .       g.3571
 atcataatcgacttcctgctcgtctccatttacaaaaactgaagggtgaaatatgtcaat       c.*420

          .         .         .         .         .    | 04    .    g.5262
 catgatttgcttctcctcctttctgatatccagtttaggtggtccaatttttc | catctcg    c.*480

          .         .         .         .         .         .       g.5322
 gcatacagcaaattcttctgactttgcataggcagattctttttgtccaaccctggcttt       c.*540

          .         .         .         .         .         .       g.5382
 aactctgacccaaagagaatttgatggatcaccaacatgatcagaaatattacaataatg       c.*600

          .         .         .         .       | 05 .         .    g.6096
 atgagaaatattgatgcaggcatcaatccattctgaattcttaaca | ccatagttctttac    c.*660

          .         .         .         .         .         .       g.6156
 ctctacggtaaaaacagggacctgtggcatgatctggtactcccaatatacgatagggtt       c.*720

          .         .         .         .  | 06      .         .    g.18381
 catgttataggattcaattgtaacattagttggtgtaggca | ctgaggacggccccagatc    c.*780

          .         .         .         .         .         .       g.18441
 cgcggtgcccatctcagccctgctcacaccctgcatgacaaggggtaggagaaagaggag       c.*840

          .         .         .         .         .         .       g.18501
 agccatgctgctaccgacggtcgctggctccaaccccgagcgcctgcgggaccagcccag       c.*900

          .         .         .         .          | 07        .              g.18561
 cactgccctccagccccggccttacgtcacttccgtcaccggggtctgt | c              c.*950

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interferon gamma receptor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.