inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG) - 605 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)
         .         .         .         .         .         .  g.21770
gtgagggccctcctctctgacccaccctggcactgggacctggagagtctctttggcgtc  c.1116+60

         .         .         .         .         .         .  g.21830
tttttttttttttttgcttttgctttttgagattgagttttgctcttgttgcccaggctg  c.1116+120

         .         .         .         .         .         .  g.21890
gagtgccactagtggcacgatcttggctcactgcaacctctgcctcccgggttcaaacaa  c.1116+180

         .         .         .         .         .         .  g.21950
ttctcttgcctcagcctcctgagtagctgggattacaggcgcctgccgccatgcccgtct  c.1116+240

         .         .         .         .         .         .  g.22010
aatttttgtatttttagtagagacagggtttcaccatgttggcccagctggtctcgaact  c.1116+300

     g.22013
tct  c.1116+303

--------------------- middle of intron ---------------------
                                              g.22014         g.22015
                                              c.1117-302  gg  c.1117-301

.         .         .         .         .         .           g.22075
cctcaggtgatctgcccaccgcagtctctcaaagttctgggattacaggcgtgagccacc  c.1117-241

.         .         .         .         .         .           g.22135
gcacccggcctctttggcatcattttgtagtggcctttcgtaagcttctgagccacttgt  c.1117-181

.         .         .         .         .         .           g.22195
gctgctccttagacctctcggtgagcttggcattactcgccgacgtatctgtttcctctg  c.1117-121

.         .         .         .         .         .           g.22255
cgccgctgggggctctgggaggacagcagtgggttctgctttgttcctgtggtgcctggc  c.1117-61

.         .         .         .         .         .           g.22315
gcagtgcctggtgggtggctggcttgtggcgggcacatccctttctgttggatttgccag  c.1117-1