inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG) - 298 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.22837
gtgagtgagcgagaactgggcctgcgggaggaggtgggtggggagggcaggtgctgcgcc  c.1321+60

         .         .         .         .         .         .  g.22897
gcgggaggtcacagttcgaccttcctgttgctctctggagacttgacggcgggagctcgt  c.1321+120

         .         .           g.22926
gtaggccaccccatcggtagcccaccccc  c.1321+149

--------------------- middle of intron ---------------------
                   g.22927              .         .           g.22955
                   c.1322-149  ttccccgaggctaagggaggcatgccgtg  c.1322-121

.         .         .         .         .         .           g.23015
gtagcggcggctcctggtcttacatgagtggcctgtgagaccaggcctgccattgacagt  c.1322-61

.         .         .         .         .         .           g.23075
cctgccaagtctccgtccccctccatcctccccttccctctgactcttctcttttcccag  c.1322-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center