interleukin 10 (IL10) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the IL10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering IL10 transcript NM_000572.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTATTAAAGGCATTCTTCACCTGCTCCACGGCCTTGCTCTTGTTTTCACAGGGAAGAAA       c.60
 L  I  K  G  I  L  H  L  L  H  G  L  A  L  V  F  T  G  K  K         p.20

        | 02 .                                                      g.1132
 TCGATG | ACAGCGCCGTAG                                              c.78
 S  M   | T  A  P  X                                                p.25

          .         .         .         .         .         .       g.1192
 cctcagcctgagggtcttcaggttctcccccagggagttcacatgcgccttgatgtctgg       c.*60

          .         .         .         .         .         .       g.1252
 gtcttggttctcagcttggggcatcacctcctccaggtaaaactggatcatctcagacaa       c.*120

          .         .  | 03      .         .         .         .    g.1608
 ggcttggcaacccaggtaacc | cttaaagtcctccagcaaggactcctttaacaacaagtt    c.*180

          .         .  | 04      .         .         .         .    g.2523
 gtccagctgatccttcatttg | aaagaaagtcttcactctgctgaaggcatctcggagatc    c.*240

          .         .         .         .         .         .       g.2583
 tcgaagcatgttaggcaggttgcctgggaagtgggtgcagctgttctcagactgggtgcc       c.*300

          .         .         .         .         .         .       g.2643
 ctggcctgggctggccctcaccccagtcaggaggaccaggcaacagagcagtgctgagct       c.*360

          .         .         .         .         .         .       g.2703
 gtgcatgccttcttttgcaagtctgtcttgtggtttggttttgcaagagcaagcccctga       c.*420

       | 05  .         .         .         .         .         .                                                          g.2763
 tgtgt | g                                                          c.*426

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 10 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.