interleukin 12B (IL12B) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the IL12B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000005.9, covering IL12B transcript NM_002187.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.2914
                                                 ctaactgcaggg       c.-121

 .         .         .         .         .         .                g.2974
 cacagatgcccattcgctccaagatgagctatagtagcggtcctgggcccgcacgctaat       c.-61

 .         .         .         .         .         .                g.3034
 gctggcatttttgcggcagatgaccgtggctgaggtcttgtccgtgaagactctatcttt       c.-1

  | 02       .         .         .         .         .         .    g.5013
  | CTTTTCTCTCTTGCTCTTGCCCTGGACCTGAACGCAGAATGTCAGGGAGAAGTAGGAATG    c.60
  | L  F  S  L  A  L  A  L  D  L  N  A  E  C  Q  G  E  V  G  M      p.20

          .         .         .         .         .         .       g.5073
 TGGAGTACTCCAGGTGTCAGGGTACTCCCAGCTGACCTCCACCTGCCGAGAATTCTTTAA       c.120
 W  S  T  P  G  V  R  V  L  P  A  D  L  H  L  P  R  I  L  X         p.39

          .         .         .         | 03         .         .    g.6545
 tggcttcagctgcaagttcttgggtgggtcaggtttga | tgatgtccctgatgaagaagct    c.*60

          .         .         .         .         .         .       g.6605
 gctggtgtagttttcatacttgagcttgtgaacggcatccaccatgacctcaatgggcag       c.*120

          .         .         .         .         .         .       g.6665
 actctcctcagcagctgggcaggcactgtcctcctggcactccactgagtactcatactc       c.*180

          .         .         .         .         .         .       g.6725
 cttgttgtcccctctgactctctctgcagagagtgtagcagctccgcacgtcaccccttg       c.*240

          .    | 04    .         .         .         .         .    g.8658
 ggggtcagaagag | cctctgctgcttttgacactgaatgtcaaatcagtactgattgtcgt    c.*300

          .         .         .         .         .         .       g.8718
 cagccaccagcaggtgaaacgtccagaataattcttggcctcgcatcttagaaaggtctt       c.*360

          .  | 05      .         .         .         .         .    g.9320
 atttttgggtt | ctttctggtcctttaaaatatcagtggaccaaattccatcttccttttt    c.*420

          .         .         .         .         .         .       g.9380
 gtgaagcagcaggagcgaatggcttagaacctcgcctcctttgtgacaggtgtactggcc       c.*480

          .         .         .         .         .         .       g.9440
 agcatctccaaactctttgacttggatggtcagggttttgccagagcctaagacctcact       c.*540

          .         .         .         .         .         .       g.9500
 gctctggtccaaggtccaggtgataccatcttcttcaggggtgtcacaggtgaggaccac       c.*600

          .         .         .         .        | 06.         .    g.12925
 catttctccaggggcatccggataccaatccaattctacgacataaa | catctttcttcag    c.*660

          .         .         .         .         .         .       g.12985
 ttcccatatggccacgaggggagatgccagaaaaaccagggaaaaccaagagatgaccaa       c.*720

          .      | 07  .         .         .         .        | 08.   g.16694
 ctgctggtgacacat | cttgctctgggcaggacggagagtccaatggccctgaaacag | c   c.*778

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 12B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.