interleukin 12 receptor, beta 1 (IL12RB1) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the IL12RB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering IL12RB1 transcript NM_005535.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTGGCCTTGCACCTGTCTCCATCCTCCAAGGACAACTCTGTATCCAGGGCCAGCTCAGG       c.60
 L  G  L  A  P  V  S  I  L  Q  G  Q  L  C  I  Q  G  Q  L  R         p.20

          .                                                         g.75
 GGCACCCTCAGGTAG                                                    c.75
 G  T  L  R  X                                                      p.24

          .         .         .         .         .         .       g.135
 ctctgtcttctcgagaggctcagtcctctcgcctttgtcccaggacatctctaccaccag       c.*60

          .         .         .         .         .        | 02.    g.1231
 ggcctcctgcagggatgcctcttcctggaagtccactgggttgatccactgccaagt | ctc    c.*120

          .         .         .         .         .         .       g.1291
 cttccctccagggaactcaatggcggagctggcacagggtgtgggcagcggcgggcacag       c.*180

          .    | 03    .         .         .         .         .    g.2334
 gtgccgtgcggcc | ctgttcaggccaaggtagccaaggacgcccacgagaaggatgctcag    c.*240

          .         .         .         .         . | 04       .    g.3992
 gaagctccccagggaggcgaagaagatgagccaatcagaaacctgcactt | cgatgctgaa    c.*300

          .         .         .         .         .         .       g.4052
 gcgctggggctggctccagacacccctcagccacgctgtgtctgctcgcacctgcaccgt       c.*360

          .         .         .         .         .         .       g.4112
 gtaggctacaccagcccgcaggccactgagggtaacttgggtctctgtgggctgcacggg       c.*420

       | 05  .         .         .         .         .         .    g.6703
 atgct | ctgacacctgtttgctgtcttcatctcggcagcggacaacatactcctttaggac    c.*480

          .         .         .         .         .         .       g.6763
 gccgggacaggtgctcagcagggatggtgcccagtccacagacacagagtccaagctatg       c.*540

          .         .         .         .  | 06      .         .    g.8514
 attcttcaccgagacgtggtgcggtgtcccagctgctgagg | cattgcccccaaagtggta    c.*600

          .         .         .         .         .         .       g.8574
 ggtggacaggaccgtagaccacaaggtgagcttctcggggtgcgcagaggcaaagatggt       c.*660

          .         .         .         .         .          | 07    g.9653
 aatgtagtaacacttttcctgccccattgccccagactctcgactccagctgtaggttg | c    c.*720

          .         .         .         .         .         .       g.9713
 cattccagccggatccgggtcttgcggcgcagtcaggctgcaggtggcaaggcccccgtc       c.*780

          .         .         .         .         .         .       g.9773
 ctggcccacaggctgccattcaatgcaatacgtcatgctctgagcccgggctggccaata       c.*840

          .         .         .         .        | 08.         .    g.12231
 catggtggtcccgttggttccgacgctgatattcagagccactggtt | ctgtgtgggtgtc    c.*900

          .         .         .         .         .         .       g.12291
 ggcaggaatgtgccacgtctggttcaggccaggaccaaattggttcgaggagatgacagc       c.*960

          .         .         .         .         .         .       g.12351
 cacgttgtaggcagcacccgagagatagggcatcttccccaggtgcagggtcctggtggc       c.*1020

          .         .         .         .         .         .       g.12411
 cttggccttacacgggcaggacagcatgtggagctgtagtcggtaagtgacctccgtgcc       c.*1080

          .         .         .         .      | 09  .         .    g.13638
 aggcgccagcccttgacagccttctggaagctccagctgggttgg | ctgctctttcagggt    c.*1140

          .         .         .         .         .         .       g.13698
 cagccgcctcctcccatcctggcccagctgctccaccgagaatctcacctgaggctgtgg       c.*1200

          | 10         .         .         .         .         .    g.15907
 ggggtttt | cagggggaacgcacacggggctgctccacttgctccaggaacttccttggct    c.*1260

          .         .         .         .         .         .       g.15967
 ccccagctgccgtcgtcggagctggaattcctgggccacattcatctccagggggcagag       c.*1320

          | 11         .         .          | 12        .         . g.17643
 gcaggact | cagtatcatcatcctgaggtccgcagtcgcc | caacttccatgggctgctggg c.*1380

          .         .         .         .         .         .       g.17703
 tgtccggtgccggaactgcacctcagcaccaacctggttatccggggtctcccactccat       c.*1440

          .         .         .         .         .          | 13    g.20939
 acgcagctgcccggccaacttggacaccttgatgtctcccagaggaggctcatatttaa | c    c.*1500

          .         .         .         .         .         .       g.20999
 tgagttgtagagctgcagggtcacctcaggagacttctctgtctggttcctggcccagga       c.*1560

          .         .         .         .         .         .       g.21059
 ttccacccagagtgtgacagtgtacagcacagacaccccagcctggtcggagaactgcag       c.*1620

          .         .         .         .          | 14        .    g.22267
 cctggtggctgagccggcggcgaagtagcagcagcgcccggagctaagg | caacaccgcag    c.*1680

          .         .         .         .         .         .       g.22327
 gaagtggctgaccccagctgtgggaccctcatactgccaggagcactcgtaacgatcact       c.*1740

          .         .         .         .     | 15   .         .    g.23554
 ggatatccgatagcatctcaggtccctagggcccgaggccgagc | ctgagtctgcatccgg    c.*1800

          .         .         .         .     | 16   .         .    g.26882
 atatggcgggtcctgaaaacagcactcactggttctgcaggcag | cgccctgcctggacag    c.*1860

          .         .         .         .         .         .       g.26942
 caggaagaggaagaggagggggaccacccaggtcaccagcggctccatcggatccacgta       c.*1920

          .         .         .         .         .   | 17     .           g.27002
 gagccccacagccccaggggagcctctctgccacctgcgaggttcagccacc | t           c.*1973

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 12 receptor, beta 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.