interleukin 17F (IL17F) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2014)

This file was created to facilitate the description of sequence variants in the IL17F gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering IL17F transcript NM_052872.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.6
 GTGTAA                                                             c.6
 V  X                                                               p.1

          .         .         .         .         .         .       g.66
 ttccagggggaggtggagcggctctcgatgttacgtgacatggaaacgcgctggttttca       c.*60

          .         .         .         .         .         .       g.126
 ttgatgatgccaatgtcaagcttcatactacctcctggcacaggcgggcaactctcaggc       c.*120

          .         .         .         .         .         .       g.186
 ttttggaaaaaagtatgtcctactttggggattttccgagctgccgcctcactcagaaag       c.*180

          .         .         .      | 02  .         .         .    g.5692
 gcaagccccaatatcgacagcagcaagtacttgac | catggctgggccatgcagggtcttc    c.*240

          .         .         .         .         .         .       g.5752
 actgtcatgttgcgctggtggcttactttgtgcaggaagctctttctgtgaatgtatctt       c.*300

          .          | 03        .         .         .         .                                            g.5812
 cctgtgtatgcctgtgttc | a                                            c.*320

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 17F protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.