interleukin 2 receptor, alpha (IL2RA) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the IL2RA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering IL2RA transcript NM_000417.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 TGTCTCCGCTGCCAGGTGAGCCCACTCAGGAGGAGGACGCTGATCAGCAGGAAAACACAG       c.60
 C  L  R  C  Q  V  S  P  L  R  R  R  T  L  I  S  R  K  T  Q         p.20

         | 02.         .         .         .         .         .    g.1428
 CCGGCCA | CTGCTACCTGGTACTCTGTTGTAAATATGGACGTCTCCATGGTTGCAGCCATT    c.120
 P  A  T |   A  T  W  Y  S  V  V  N  M  D  V  S  M  V  A  A  I      p.40

          .                                                     g.1443
 TCTGTCTGTATTTGA |                                                 c.136
 S  V  C  I  X                                                   p.44

      | 03   .         .         .         .         .         .    g.1873
 aaat | ctgttgttgtgacgaggcaggaagtctcactctcaggacggccttcggggcttgcc    c.*60

          .       | 04 .         .         .         .         .    g.3469
 tgaggcttctcttcac | ctggaaactgactggtctccatttcacctgtgcatatgagctgg    c.*120

          .         .         .         .         .         .       g.3529
 ggctgggtccaccttgtcttcccgtgggtcattttgcagacgctctcagcaggacctctg       c.*180

          .         .         .         .         .         .       g.3589
 tgtagagccctgtatccctggacgcactgataataaaccatctgccccaccacgaaatga       c.*240

          .         .         .         .         .   | 05     .    g.6199
 taaattctctctgtggcttcattttcccatggtggaggttccctgcagtgac | ctggaagg    c.*300

          .         .         .         .         .         .       g.6259
 ctcgcttggtccactggctgcattggactttgcatttctgtggttttcctttctttctgt       c.*360

          .         .         .         .    | 06    .         .    g.7798
 tcttcaggttgaggtgtcacttgtttcgttgtgttccgagtgg | cagagcttgtgcattga    c.*420

          .         .         .         .         .         .       g.7858
 cattggttgtcccaggacgagtggctagagtttcctgtacagagcatatagagtgacccg       c.*480

          .         .         .         .         .         .       g.7918
 ctttttattctgcggaaacctctcttgcattcacagttcaacatggttccttccttgtag       c.*540

          .         .         .         .         .      | 07  .    g.44040
 gccatggctttgaatgtggcgtgtgggatctctggcgggtcatcgtcacagagct | ctgcc    c.*600

          .         .         .         .         .         .       g.44100
 tggcagccaggcaccatgatgaacgtgagcagtccccacatcagcaggtatgaatccatc       c.*660

          .         .         .         .         .         .       g.44160
 ttcctgacccttgggaccagccggggcagtgaagcggaggtctttctctgcagaaggccc       c.*720

          .         .         .         .         .         .       g.44220
 agttgccgtcagcctctttttggcatcgcgccggaggatgtgggatgggaagatcggtcc       c.*780

          .         .         .         .         .         .       g.44280
 gcctgggctgtcacccttgtgggtccatccagtctctatcggagtcaggagttgctctct       c.*840

          .         .         .         | 08         .         .                         g.44340
 ttaagtattgggctggcgtgttcagccaggaaactgcc | a                         c.*879

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 2 receptor, alpha protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.