interleukin 36 receptor antagonist (IL36RN) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the IL36RN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering IL36RN transcript NM_012275.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.1511
                    cgctgggaatcctgctcctcctcaggtcctggcagtttcag       c.-121

 .         .         .         .         .         .                g.1571
 ggcccctccctaggccttacttaaaaggctgaggcatccttggaggaacaggcagactcc       c.-61

 .         .         .         .   | 02     .         .             g.1801
 acagctcccgccaggagaaaggaacattctgag | gggagtctacaccctgtggagctcaag    c.-1

          .         .          | 03        .         .         .    g.3245
 ATGGTCCTGAGTGGGGCGCTGTGCTTCCG | AATGAAGGACTCGGCATTGAAGGTGCTTTAT    c.60
 M  V  L  S  G  A  L  C  F  R  |  M  K  D  S  A  L  K  V  L  Y      p.20

          .         .         .         .         .      | 04  .    g.4491
 CTGCATAATAACCAGCTTCTAGCTGGAGGGCTGCATGCAGGGAAGGTCATTAAAG | GTGAA    c.120
 L  H  N  N  Q  L  L  A  G  G  L  H  A  G  K  V  I  K  G |   E      p.40

          .         .         .         .         .         .       g.4551
 GAGATCAGCGTGGTCCCCAATCGGTGGCTGGATGCCAGCCTGTCCCCCGTCATCCTGGGT       c.180
 E  I  S  V  V  P  N  R  W  L  D  A  S  L  S  P  V  I  L  G         p.60

          .         .         .         .         .         .       g.4611
 GTCCAGGGTGGAAGCCAGTGCCTGTCATGTGGGGTGGGGCAGGAGCCGACTCTAACACTA       c.240
 V  Q  G  G  S  Q  C  L  S  C  G  V  G  Q  E  P  T  L  T  L         p.80

     | 05    .         .         .         .         .         .    g.4872
 GAG | CCAGTGAACATCATGGAGCTCTATCTTGGTGCCAAGGAATCCAAGAGCTTCACCTTC    c.300
 E   | P  V  N  I  M  E  L  Y  L  G  A  K  E  S  K  S  F  T  F      p.100

          .         .         .         .         .         .       g.4932
 TACCGGCGGGACATGGGGCTCACCTCCAGCTTCGAGTCGGCTGCCTACCCGGGCTGGTTC       c.360
 Y  R  R  D  M  G  L  T  S  S  F  E  S  A  A  Y  P  G  W  F         p.120

          .         .         .         .         .         .       g.4992
 CTGTGCACGGTGCCTGAAGCCGATCAGCCTGTCAGACTCACCCAGCTTCCCGAGAATGGT       c.420
 L  C  T  V  P  E  A  D  Q  P  V  R  L  T  Q  L  P  E  N  G         p.140

          .         .         .         .                           g.5040
 GGCTGGAATGCCCCCATCACAGACTTCTACTTCCAGCAGTGTGACTAG                   c.468
 G  W  N  A  P  I  T  D  F  Y  F  Q  Q  C  D  X                     p.155

          .         .         .         .         .         .       g.5100
 ggcaacgtgccccccagaactccctgggcagagccagctcgggtgaggggtgagtggagg       c.*60

          .         .         .         .         .         .       g.5160
 agacccatggcggacaatcactctctctgctctcaggacccccacgtctgacttagtggg       c.*120

          .         .         .         .         .         .       g.5220
 cacctgaccactttgtcttctggttcccagtttggataaattctgagatttggagctcag       c.*180

          .         .         .         .         .         .       g.5280
 tccacggtcctcccccactggatggtgctactgctgtggaatcttgtaaaaaccatgtgg       c.*240

          .         .         .         .         .         .       g.5340
 ggtaaactgggaataacatgaaaagatttctgtggaggtggggtgggggagtggtgggaa       c.*300

          .         .         .         .         .         .       g.5400
 tcattcctgcttaatggtaactgaccagtgttaccctgagccccgcaggccaacccatcc       c.*360

          .         .         .         .         .         .       g.5460
 ccagttgagccttatagggtcagtagctctccacatgaagacctgtcactcaccactatg       c.*420

          .         .         .         .         .         .       g.5520
 caggagagggaggtggtcatagagtcagggatctatggcccttggcccagccccacctcc       c.*480

          .         .         .         .         .         .       g.5580
 ttccctttaatcctgccactgtcatatgctacctttcctatctcttccctcatcatcttg       c.*540

          .         .         .         .         .         .       g.5640
 ttgtgggcatgaggaggtgctgatgtcagaagaaatggctcgagctcagaagataaaaga       c.*600

          .         .         .         .         .         .       g.5700
 taagtagggtatgctgatcctcttttaaaaacccaagatacaatcaaaatcccagatgct       c.*660

          .         .         .         .         .         .       g.5760
 ggtctctattcccatgaaaaagtgctcatgacatattgagaagacctacttacaaagtgg       c.*720

          .         .         .         .         .         .       g.5820
 catatattgcaatttattttaattaaaagatacctatttatatatttctttatagaaaaa       c.*780

          .         .         .         .         .         .       g.5880
 agtctggaagagtttacttcaattgtagcaatgtcagggtggtggcagtataggtgattt       c.*840

          .         .         .         .         .         .       g.5940
 ttcttttaattctgttaatttacctgtatttcctaatttttctacaatgaagatgaattc       c.*900

          .         .         .         .         .         .       g.6000
 cttgtataaaaataagaaaagaaattaatcttgaggtaagcagagtagacatcatctctg       c.*960

          .         .         .         .         .         .       g.6060
 attgtcctcagcctccacttccccagagtaaattcaaattgaatcgagctctgctgctct       c.*1020

          .         .         .         .         .         .       g.6120
 ggttggttgtagtagtgatcaggaaacagatctcagcaaagccactgaggaggaggctgt       c.*1080

          .         .         .         .         .         .       g.6180
 gctgagtttgtgtggctggaatctctgggtaaggaacttaaagaacaaaaatcatctggt       c.*1140

          .         .         .         .         .         .       g.6240
 aattctttcctagaaggatcacagcccctgggattccaaggcattggatccagtctctaa       c.*1200

          .         .         .         .         .         .       g.6300
 gaaggctgctgtactggttgaattgtgtccccctcaaattcacatccttcttggaatctc       c.*1260

          .         .         .         .         .         .       g.6360
 agtctgtgagtttatttggagataaggtctctgcagatgtagttagttaagacaaggtca       c.*1320

          .         .         .         .         .         .       g.6420
 tgctggatgaaggtagacctaaattcaatatgactggtttccttgtatgaaaaggagagg       c.*1380

          .         .         .         .         .         .       g.6480
 acacagagacagaggagatgcggggaagactatgtaaagatgaaggcagagatcggagtt       c.*1440

          .         .         .         .         .         .       g.6540
 ttgcagccacaagctaagaaacaccaaggattgtggcaaccatcagaagcttggaagagg       c.*1500

          .         .         .         .         .         .       g.6600
 caaagaagaattcttccctagaggctttagagggataacggctctgctgaaaccttaatc       c.*1560

          .         .         .         .         .         .       g.6660
 tcagacttccagcctcctgaacgaagaaagaataaatttcggctgttttaagccaccaag       c.*1620

          .         .         .         .         .         .       g.6720
 gataattggttacagcagctctaggaaactaatacagctgctaaaatgatccctgtctcc       c.*1680

          .         .         .         .         .         .       g.6780
 tcgtgtttacattctgtgtgtgtcccctcccacaatgtaccaaagttgtctttgtgacca       c.*1740

          .         .         .         .         .         .       g.6840
 atagaatatggcagaagtgatggcatgccacttccaagattaggttataaaagacactgc       c.*1800

          .         .         .         .         .         .       g.6900
 agcttctacttgagccctctctctctgccacccaccgcccccaatctatcttggctcact       c.*1860

          .         .         .         .         .         .       g.6960
 cgctctgggggaagctagctgccatgctatgagcaggcctataaagagacttacgtggta       c.*1920

          .         .         .         .         .         .       g.7020
 aaaaatgaagtctcctgcccacagccacattagtgaacctagaagcagagactctgtgag       c.*1980

          .         .         .         .         .         .       g.7080
 ataatcgatgtttgttgttttaagttgctcagttttggtctaacttgttatgcagcaata       c.*2040

          .         .                                               g.7107
 gataaataatatgcagagaaagagaaa                                        c.*2067

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Interleukin 36 receptor antagonist protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.