ISG15 ubiquitin-like modifier (ISG15) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the ISG15 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering ISG15 transcript NM_005101.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.1047
              ataatagggccggtgctgcctgccgaagccggcggctgagaggcagc       c.-61

 .         .         .         .         .         .                g.1107
 gaactcatctttgccagtacaggagcttgtgccgtggcccacagcccacagcccacagcc       c.-1

     | 02    .         .         .         .         .         .    g.1574
 ATG | GGCTGGGACCTGACGGTGAAGATGCTGGCGGGCAACGAATTCCAGGTGTCCCTGAGC    c.60
 M   | G  W  D  L  T  V  K  M  L  A  G  N  E  F  Q  V  S  L  S      p.20

          .         .         .         .         .         .       g.1634
 AGCTCCATGTCGGTGTCAGAGCTGAAGGCGCAGATCACCCAGAAGATCGGCGTGCACGCC       c.120
 S  S  M  S  V  S  E  L  K  A  Q  I  T  Q  K  I  G  V  H  A         p.40

          .         .         .         .         .         .       g.1694
 TTCCAGCAGCGTCTGGCTGTCCACCCGAGCGGTGTGGCGCTGCAGGACAGGGTCCCCCTT       c.180
 F  Q  Q  R  L  A  V  H  P  S  G  V  A  L  Q  D  R  V  P  L         p.60

          .         .         .         .         .         .       g.1754
 GCCAGCCAGGGCCTGGGCCCCGGCAGCACGGTCCTGCTGGTGGTGGACAAATGCGACGAA       c.240
 A  S  Q  G  L  G  P  G  S  T  V  L  L  V  V  D  K  C  D  E         p.80

          .         .         .         .         .         .       g.1814
 CCTCTGAGCATCCTGGTGAGGAATAACAAGGGCCGCAGCAGCACCTACGAGGTACGGCTG       c.300
 P  L  S  I  L  V  R  N  N  K  G  R  S  S  T  Y  E  V  R  L         p.100

          .         .         .         .         .         .       g.1874
 ACGCAGACCGTGGCCCACCTGAAGCAGCAAGTGAGCGGGCTGGAGGGTGTGCAGGACGAC       c.360
 T  Q  T  V  A  H  L  K  Q  Q  V  S  G  L  E  G  V  Q  D  D         p.120

          .         .         .         .         .         .       g.1934
 CTGTTCTGGCTGACCTTCGAGGGGAAGCCCCTGGAGGACCAGCTCCCGCTGGGGGAGTAC       c.420
 L  F  W  L  T  F  E  G  K  P  L  E  D  Q  L  P  L  G  E  Y         p.140

          .         .         .         .         .         .       g.1994
 GGCCTCAAGCCCCTGAGCACCGTGTTCATGAATCTGCGCCTGCGGGGAGGCGGCACAGAG       c.480
 G  L  K  P  L  S  T  V  F  M  N  L  R  L  R  G  G  G  T  E         p.160

          .                                                         g.2012
 CCTGGCGGGCGGAGCTAA                                                 c.498
 P  G  G  R  S  X                                                   p.165

          .         .         .         .         .         .       g.2072
 gggcctccaccagcatccgagcaggatcaagggccggaaataaaggctgttgtaaagaga       c.*60

                                                                    g.2074
 aa                                                                 c.*62

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The ISG15 ubiquitin-like modifier protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.