Janus kinase 3 (JAK3) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)


This file was created to facilitate the description of sequence variants in the JAK3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering JAK3 transcript NM_000215.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTCAGCAGGGCAGGCAGGAGGCGCCGGCAGCCTCTGGCCCTCCTCCAGCAGTTCCAAGAG       c.60
 L  S  R  A  G  R  R  R  R  Q  P  L  A  L  L  Q  Q  F  Q  E         p.20

          .         .         .         .         .  | 02      .    g.404
 GCGGCAGAGGGCGGGGACATCCCGCTCACATCCCATCATCCGCAGGAACTC | GGCCGAGGG    c.120
 A  A  E  G  G  D  I  P  L  T  S  H  H  P  Q  E  L   | G  R  G      p.40

          .         .         .         .         .         .       g.464
 GCTGCAGCTTTTGTCGCAGTAGGTGAAGAGCTCGTACAGGACGACCCCGAAGCTCCAGAC       c.180
 A  A  A  F  V  A  V  G  E  E  L  V  Q  D  D  P  E  A  P  D         p.60

                                                                g.470
 GTCTGA |                                                          c.187
 V  X                                                            p.61

          .         .         .         .    | 03    .         .    g.1137
 ctggcgagagaagatgttgtccgagagggattcgggggcatac | cagaaaatggggctctg    c.*60

          .         .         .         .         .         .       g.1197
 gcctggctcgcggaccacgtagtagtctttgtcaagcggcagcagcttagctaggccgaa       c.*120

          .         .         .         .         .         .       g.1257
 gtcagcgatcttgacgtgtgcctcgctctccacgaggatgtttcgggcggccaggtcgcg       c.*180

          .         .         .       | 04 .         .         .    g.1590
 gtgcacgcagcggcgggagcccaggtactccatgcc | cttgcagatctgcgaggaatagag    c.*240

          .         .         .         .         .         .       g.1650
 aaggaggcggctggcatcgaggcgcgcgcggtgccgctgcaggaagtcgcgcaagcagcc       c.*300

          .         .         .         .  | 05      .         .    g.2430
 gctgggcaggtactccatgaccagccgcaggctctggcggc | ccgggccatagctgacacc    c.*360

          .         .         .         .         .         .       g.2490
 acgatacttgacaatgaaatcactgtgcagtgctttgaggatctgaatctcccgctgaaa       c.*420

          .         .         .         .         .         .       g.2550
 gtccctctgctggtctggcccgctgtgctgcagctgtttcacggccaccagggcacctgt       c.*480

          .         .         .         .         .  | 06      .    g.2691
 attgtcgcctagcgggtcatagcggcacagctccacgctgccaaagttgcc | cttgcccag    c.*540

          .         .         .         .         .         .       g.2751
 ctgtgagatgtacttgaggtgtctctcctcgaagatcgtggggtcttggcaggcatagag       c.*600

          .         .         .         .         .         .       g.2811
 ctgggcaccattccacagcccatcacgaggtgccagggcaccaggtgtggggtctgagag       c.*660

          .  | 07      .         .         .         .         .    g.4512
 gagctcatagt | ctgaagagatgaggctattgaggtcacgaatgacggctcggaaggaggg    c.*720

          .         .         .         .         .         .       g.4572
 cctctggaccggctcataggccatgcactgttgaatcagcagggccagctctgtccactt       c.*780

          .         .         .         .   | 08     .         .    g.4762
 gggggccggcagctgctgccggtcctcataaaattggagttt | cttagcaggatccagggc    c.*840

          .         .         .         .         .         .       g.4822
 actgatgggcatggtgacgccactaaacacttcccagaccgtggcgccgaagccccactt       c.*900

          .         .         .         .         .         .       g.4882
 gtcagcttccaagctaagtgtctgcgcctcccggagacactcgggggccacccaggggat       c.*960

          .     | 09   .         .         .         .         .    g.5021
 cctgtcggtgagca | tctccaggcttaacacagcggggctgaccccagggtcactcagctt    c.*1020

          .         .         .         .         .         .       g.5081
 gatgaagggcgggctcccatcagccccctcccgagccaggagcaccttccgggcagagac       c.*1080

          .         .        | 10.         .         .         .    g.5849
 attgccatggggcaggcctttgtcctc | cagatagttgagggcgtaggccagctgtttgac    c.*1140

          .         .         .         .         .         .       g.5909
 cacctgcagcttccagctggctggcaccaggtggccacgttttcgcagatacatgtctat       c.*1200

          .         .         .      | 11  .         .         .    g.7046
 ggcccccaggtgtacaaattcctgcaccatggtgc | tgtctccagccatgcacacgccgtg    c.*1260

          .         .         .         .         .         .       g.7106
 gagcagcacgagatgccggtacgacacttggctcatcaagctcgctgcttccaggaatga       c.*1320

  | 12       .         .         .         .         .         .    g.7884
  | ctccatgcagttcttgtgcttggcatccatgaccttcagcagcacctctgtctttcgggc    c.*1380

          .         .         .         .         .         .       g.7944
 ctccccatccaccacctcatggcgacagccccggtaaatcttggtgaaggacccatggcc       c.*1440

          .   | 13     .         .         .         .         .    g.8203
 caggttctcatg | ccactccaggctgtcagcagggatcttgtgaaatgtcatctgactcag    c.*1500

          .         .         .         .         .         .       g.8263
 ctggtattgggattggggctgaaccaaggatgatgtgggtgggctgtgacctctctggac       c.*1560

          .         . | 14       .         .         .         .    g.9409
 cacgatcaggttggactttt | ctttgggtctggggatacagcaggaagtgagggtcactgc    c.*1620

          .         .         .         .         .         .       g.9469
 caccccatctacgtgcagccccccatcccagcaggttgccaggagctctcgaagactgct       c.*1680

          .         .         .         .         .         .       g.9529
 gtggggtcggctgaggccaaccagaaggaaggttcctgtggggctgcgccggatgaggca       c.*1740

          .         .        | 15.         .         .         .    g.10155
 gcccttataatcaggaccaagggggtt | ctggacacagacagtgaggaggaagctgtcaaa    c.*1800

          .         .         .         .         .         .       g.10215
 gtcctgggggctgcggcggagaacataggagccaggacgtgagcccccagtcttgagctt       c.*1860

          .          | 16        .         .         .         .    g.11322
 gttgatggcaaagtccaga | gtgatggggccgtggcactgctcggccacttcctccagcag    c.*1920

          .         .         .         .         .         .       g.11382
 cctcggcggtgccacctccttgcagaagaagtgctgggagtccgtggtcagccggaagta       c.*1980

          .         .         .         .         .        | 17.    g.11535
 gccgtccacgagcgccacgaacgacagagcctcgggcagccctgggaactcggcctc | taa    c.*2040

          .         .         .         .         .         .       g.11595
 aatctggttgtctgtcctggtaacagtgaccaggcggtgctctccggccgggccaacgcg       c.*2100

          .         .         .         .         .         .       g.11655
 cggggcctgcttgatgctaatgtctacgatttctggaaagtcgcagaagggctggaggac       c.*2160

  | 18       .         .         .         .         .         .    g.12268
  | ctcctgttctccctgggtccaggcgatgccgccgtcaccagccacgcggagcagccccag    c.*2220

          .         .         .         .         .         .       g.12328
 cccgtcgtggccaccaagggccccagggaggcccacgtggaaggtctcggcggccccggc       c.*2280

          .         .         .         .         .         .       g.12388
 tggatccagccgctccaggtccatgatgtacttggccatgagcgagtgccggtctgcctg       c.*2340

          .         .         .         .         .         .       g.12448
 gcaggcggccacgcggcgcagggctctgcgcaccgtcctccgaatacgcctccgcgtcac       c.*2400

          .         .         .         .         .      | 19  .    g.12924
 gaagctcaggccctggatcaggtcgcgcaggcttgggggtaggcaggccttgtag | ctgac    c.*2460

          .         .         .         .         .         .       g.12984
 agtcttcagcagctctcccggccgctgggcctgctctcgcgccatccgggccaggtccaa       c.*2520

          .         .         .         .         .         .       g.13044
 cacggccaggctgagacactcaccctgctccttgagactgaggcccacggggaggcgccc       c.*2580

          .         .  | 20      .         .         .         .    g.13311
 actcaccaggtcactgcggtg | ctgggcaaagaggtgctccaggactggcaggtcaaggat    c.*2640

          .         .         .         .         .         .       g.13371
 agcactggccaaatccttgcgtagcccgaagcggtggcacttctccagcccaaaccaatt       c.*2700

          .    | 21    .         .         .         .         .    g.13716
 ggggaagtaaaag | cgaatcctgtacagcaggacttgggtgctggcatcctccacggagaa    c.*2760

          .         .         .         .         .         .       g.13776
 gatgtggctcggggggaaccagcaggacaggtcctccgtggccagagcaaagagggagtg       c.*2820

          .        | 22.         .         .         .         .    g.14169
 gtacacaggcaggatgc | cgctggccttggcagcctgcacgcacaggtcctcagccaagtg    c.*2880

          .         .         .         .         .         .       g.14229
 gtccccaaaggagaaagataggcgctgggggggcccggggccccgagcgggcagcagcac       c.*2940

          .         .         .         .         .         .       g.14289
 atgcagggcaccagcctccgtggacaagaggctgcatgaacgctgagggatcaggggcgt       c.*3000

          .         .         .     | 23   .         .         .    g.17864
 ctcttcacttggaggtgccatgagtgcaacttgc | ctagcgggcagggaccctggactttc    c.*3060

          .         .         .         .         .         .       g.17924
 gaagggcgggcagagccgggaggcagcgagaggaaagtcccactcggctccttcctgtgt       c.*3120

   | 24      .         .         .         .         .         .                                                              g.17984
 g | a                                                              c.*3122

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Janus kinase 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center