late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2) - 305 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1292
gtgagtgcagaccacggacccgagcggcgagcgctgcagtggggcggcgcgcggctccct  c.68+60

         .         .         .         .         .         .  g.1352
gagggaggggtggggaaggatcaccaggaagggaggaagcggcagagggggcagcggctg  c.68+120

         .         .         .     g.1385
gggataccggccgggaggtcccctgtcgaaaag  c.68+153

--------------------- middle of intron ---------------------
                  g.1386      .         .         .           g.1417
                  c.69-152  ggaagccggtgtgctgggtgcttagggcatgt  c.69-121

.         .         .         .         .         .           g.1477
tccgggacacgctcaggccagagccttgctggatgtgcccttggtgggacttgggatgga  c.69-61

.         .         .         .         .         .           g.1537
aacccagacgttttactccccgctctgagcacatcgctatccctccccgcccctcaccag  c.69-1


Powered by LOVD v.2.0 Build 34
©2004-2014 Leiden University Medical Center